ID: 1093731270

View in Genome Browser
Species Human (GRCh38)
Location 12:22568298-22568320
Sequence GCCGTAGATAGCTTTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093731261_1093731270 29 Left 1093731261 12:22568246-22568268 CCTCTGCCAGCTGAGTCTGGAGT No data
Right 1093731270 12:22568298-22568320 GCCGTAGATAGCTTTGGAACAGG No data
1093731262_1093731270 23 Left 1093731262 12:22568252-22568274 CCAGCTGAGTCTGGAGTCTTTAC No data
Right 1093731270 12:22568298-22568320 GCCGTAGATAGCTTTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093731270 Original CRISPR GCCGTAGATAGCTTTGGAAC AGG Intergenic
No off target data available for this crispr