ID: 1093736375

View in Genome Browser
Species Human (GRCh38)
Location 12:22625153-22625175
Sequence GCCGCAGAGCATGCCGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093736375_1093736386 22 Left 1093736375 12:22625153-22625175 CCAGCCCCGGCATGCTCTGCGGC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 1093736386 12:22625198-22625220 ACAGGAATTTTCTCCGAGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 97
1093736375_1093736388 27 Left 1093736375 12:22625153-22625175 CCAGCCCCGGCATGCTCTGCGGC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 1093736388 12:22625203-22625225 AATTTTCTCCGAGAGCGGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 29
1093736375_1093736387 23 Left 1093736375 12:22625153-22625175 CCAGCCCCGGCATGCTCTGCGGC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 1093736387 12:22625199-22625221 CAGGAATTTTCTCCGAGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 84
1093736375_1093736389 28 Left 1093736375 12:22625153-22625175 CCAGCCCCGGCATGCTCTGCGGC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 1093736389 12:22625204-22625226 ATTTTCTCCGAGAGCGGGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1093736375_1093736383 4 Left 1093736375 12:22625153-22625175 CCAGCCCCGGCATGCTCTGCGGC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 1093736383 12:22625180-22625202 CGCGGTCCAGCTCCGACAACAGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093736375 Original CRISPR GCCGCAGAGCATGCCGGGGC TGG (reversed) Exonic
900368753 1:2322271-2322293 TCCCCTGAGCCTGCCGGGGCTGG + Intronic
901067659 1:6502082-6502104 GCTGCAGGCCATGCTGGGGCTGG + Intronic
902234063 1:15046650-15046672 GCCCCAGGACAGGCCGGGGCAGG + Intronic
902331311 1:15732372-15732394 GCAGCAGGGTATGCAGGGGCTGG - Exonic
902363230 1:15953689-15953711 GCAGCAGAGCCTCCCGGGACAGG + Intronic
902476495 1:16691313-16691335 GCTTCAGAGCCTGCAGGGGCTGG + Intergenic
902538108 1:17133377-17133399 ACCGCAGAGCCTCCCGGGCCAGG - Intergenic
903466939 1:23558455-23558477 TCCGCCGAGCGTGCCGAGGCGGG + Intronic
903556310 1:24196048-24196070 GCCGCCGGGCTTGCAGGGGCAGG + Intergenic
904618922 1:31764051-31764073 GCCGCGGAGCAGCGCGGGGCGGG + Intronic
906291435 1:44622176-44622198 GGCTCAGAGCAGGCGGGGGCTGG - Intronic
907069295 1:51519309-51519331 GCCGCAGGCGAGGCCGGGGCGGG + Exonic
912572860 1:110637402-110637424 GCAGCAGAGCAGGAAGGGGCAGG - Intergenic
919991284 1:202709926-202709948 GGCGCAGAGCCGGCCGGTGCAGG + Intronic
920013714 1:202888757-202888779 GCGGCAAAAGATGCCGGGGCGGG + Intronic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
922472848 1:225887541-225887563 GCAGCAGCGGCTGCCGGGGCCGG + Exonic
922480860 1:225939503-225939525 GCAGCAGCGGCTGCCGGGGCCGG + Exonic
922720127 1:227896079-227896101 CTCGCAGAGCATGCCCGGGGCGG + Intergenic
922798993 1:228355570-228355592 GCCCCAGGGGATGCCTGGGCAGG - Intronic
923475375 1:234326660-234326682 GCCGCAGCGCATCCCCGTGCTGG - Intergenic
1062972386 10:1659314-1659336 GCAGCAGAGGAGCCCGGGGCAGG - Intronic
1063386292 10:5618255-5618277 GCCGCAGGGCAAGCCCAGGCAGG + Intergenic
1063703872 10:8411542-8411564 GCTGCAGAGGAGGCCGTGGCAGG + Intergenic
1063957049 10:11276835-11276857 CACGCAGAGCGTGCAGGGGCTGG - Intronic
1065920328 10:30387345-30387367 ACGGCAGGGCATGACGGGGCTGG - Intergenic
1066526409 10:36284033-36284055 CCCACAGGGCATGCAGGGGCGGG + Intergenic
1067165587 10:43864210-43864232 GCTGAGGAGCATGCTGGGGCCGG - Intergenic
1067562912 10:47316375-47316397 GCAGCAGCGCATGCCAGGGAGGG + Intergenic
1073249725 10:102114331-102114353 CCCGCAGATCAGGCCCGGGCCGG + Intronic
1074591864 10:114821694-114821716 GCCGCAGGGCAGGCCTGGCCGGG + Intergenic
1075100672 10:119503997-119504019 GCTGCAGAGCCTGCCAGGGCTGG - Intronic
1075559121 10:123455818-123455840 GATGCAGAGCAGGCCCGGGCGGG + Intergenic
1076062030 10:127420423-127420445 GCAGCAGAGCAGGCTGGTGCCGG - Intronic
1076395711 10:130136310-130136332 GCCTCAGCGCAGGCAGGGGCGGG + Intergenic
1076793296 10:132787622-132787644 GGCGCAGGACAGGCCGGGGCGGG - Intergenic
1077482211 11:2821077-2821099 GCAGCAGAGCAGGCCGGACCTGG - Intronic
1080706574 11:34701250-34701272 GCAGCAGAGGAGGCCTGGGCAGG + Intergenic
1082076616 11:47980466-47980488 GCCGCCGGGCCGGCCGGGGCGGG + Intergenic
1083683445 11:64361780-64361802 GCTGCAGGGCCTGCCTGGGCAGG + Intronic
1083725528 11:64626037-64626059 GCCACAGAGCATGCAGAGGCAGG - Intronic
1089363733 11:117908555-117908577 GCTGCAGAGGGTGCTGGGGCTGG + Intronic
1089640728 11:119845580-119845602 GCAGCAGAGTGTGCCGGGCCTGG + Intergenic
1091334671 11:134757481-134757503 GCCACTGAGCAGGCCAGGGCTGG + Intergenic
1092924167 12:13258602-13258624 GTCCCAGAGCCTGCTGGGGCCGG + Intergenic
1093736375 12:22625153-22625175 GCCGCAGAGCATGCCGGGGCTGG - Exonic
1094231078 12:28104039-28104061 GGCAGGGAGCATGCCGGGGCAGG + Intergenic
1094473739 12:30825569-30825591 GCTGCAGGGCCTGCCTGGGCTGG + Intergenic
1096629742 12:52918522-52918544 GCAGCAGAACATGCATGGGCAGG - Intronic
1096674443 12:53218943-53218965 GCCGCAGTGCCTGGCGGGGGTGG - Intronic
1098022450 12:66170026-66170048 GCCGCACGGCTTGCTGGGGCTGG - Intronic
1101764083 12:107682558-107682580 TCCGCAGAGCAGGCAGGAGCTGG - Intergenic
1102716108 12:114974214-114974236 GACGCAGAGCAGGGCGGGGAAGG - Intergenic
1103320933 12:120092582-120092604 GCCCTAGGGCCTGCCGGGGCTGG + Intronic
1104455937 12:128912086-128912108 GCCAGAGAGCATGCCAGTGCCGG - Intronic
1104975789 12:132551429-132551451 GCAGAAGCGGATGCCGGGGCAGG + Intronic
1105745730 13:23375532-23375554 GCCGAGGAGCAGGCGGGGGCGGG + Intronic
1111199979 13:84922633-84922655 GCAACAGAGCAAGGCGGGGCGGG - Intergenic
1111354564 13:87080705-87080727 TCCGCAGAGCAGGTGGGGGCCGG - Intergenic
1112464853 13:99635052-99635074 GCTGCAGAGGGTGCCAGGGCTGG + Intronic
1113237028 13:108288772-108288794 GCAGCAAAGCAGGCGGGGGCAGG + Intronic
1113642248 13:111965965-111965987 GCCACAGAGCAGGGCGGGGCTGG - Intergenic
1113861602 13:113490799-113490821 GGCGCTGAGCATGCCGGGAGTGG - Exonic
1114193955 14:20461148-20461170 GCCCCAGGGTAAGCCGGGGCGGG - Exonic
1117791709 14:59348846-59348868 GCCGCAGAGGTTGCAGGGGCGGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119260931 14:73237728-73237750 TCCGGAGAGCGAGCCGGGGCGGG - Intronic
1119614832 14:76092127-76092149 ACCCCAGACCTTGCCGGGGCAGG + Intergenic
1119786903 14:77320879-77320901 GGCGCAGAGCATGTCGGGACCGG + Exonic
1123987808 15:25660174-25660196 GCTGTGGAGCAAGCCGGGGCAGG - Intergenic
1124624490 15:31300244-31300266 GCCCCAGAGCCTGCCTGGCCTGG + Intergenic
1125694089 15:41621182-41621204 GCTGCAGAGCATGCCGGGAAAGG - Intergenic
1125937396 15:43648872-43648894 GCCGGAGAGCGGGGCGGGGCGGG - Intronic
1125957573 15:43800793-43800815 GGCCAAGAGCATGTCGGGGCGGG + Intronic
1126070591 15:44861962-44861984 GAGGCAGCGCATGCAGGGGCGGG + Intergenic
1129862387 15:78872774-78872796 GCCCCAGGGCACGCCGGGACTGG - Intronic
1132325349 15:100964218-100964240 ACCGCAGATCACCCCGGGGCTGG + Intronic
1132803608 16:1765864-1765886 GGGGCAGAGGAAGCCGGGGCTGG - Intronic
1133004095 16:2868253-2868275 GCCGCAGAGGCTGCCGGGCAGGG + Intergenic
1133006474 16:2884251-2884273 GCGGCTGAGGATGCCGGTGCTGG + Intronic
1133166869 16:3954200-3954222 GTCGCTGAGCTGGCCGGGGCAGG + Intronic
1133194558 16:4159753-4159775 GCAGCAGAACATGGCGGAGCGGG + Intergenic
1135240856 16:20806328-20806350 GCCGCAGAGCAGGGCACGGCAGG - Intronic
1135417317 16:22278477-22278499 GCCACAGAGCAGGCAGGAGCAGG + Intronic
1135664640 16:24325541-24325563 GCCGCAGAGCTCGCTGGGGTTGG - Intronic
1136049014 16:27637580-27637602 GCCACAGATCTTTCCGGGGCTGG - Intronic
1138619268 16:58198244-58198266 GCGGCGGGGCGTGCCGGGGCGGG - Intergenic
1139381754 16:66536862-66536884 AGCGCAGAGAATGCCTGGGCAGG + Intronic
1141659224 16:85432866-85432888 GCTGCAGAGAGTGCCGGGGTAGG - Intergenic
1142225164 16:88873620-88873642 GCCCCAGAGCCTTCCTGGGCAGG + Intergenic
1142270760 16:89088246-89088268 GCCGCAGAGCCTGCAGTGGGAGG + Intergenic
1142428954 16:90016135-90016157 GCCCCAGAGCAGGCTGGGACTGG + Intronic
1144758629 17:17694798-17694820 CCCGCGAAGCATGCCGGGCCGGG - Intronic
1145348318 17:22055983-22056005 GCCGCTGAGCATTCTGGGGTTGG - Intergenic
1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG + Intronic
1146968410 17:37052652-37052674 GCCCCAGAGCAGGCCTGTGCTGG + Intronic
1148108623 17:45132399-45132421 GCCGCACAGCATGGCTTGGCGGG + Exonic
1148211137 17:45809378-45809400 GCCCCAGAGCATGGGGGAGCTGG - Intronic
1149547696 17:57516599-57516621 GCATCTGTGCATGCCGGGGCTGG + Intronic
1151314315 17:73312242-73312264 GCCGGAGCGCAGGCTGGGGCGGG - Intergenic
1151755349 17:76072503-76072525 GCCGCAGAGCAAGACGGGATAGG + Exonic
1152183533 17:78840341-78840363 GCCGCAGAGCTCAGCGGGGCGGG - Intronic
1152531177 17:80920132-80920154 GCTGCAGAGCTGGCTGGGGCAGG - Intronic
1153758483 18:8307130-8307152 GCAGCAGAGCATGGGGGAGCTGG + Intronic
1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG + Exonic
1160575284 18:79849521-79849543 GACGCAGAGCAAGGCGGGGAGGG - Intergenic
1161154178 19:2723590-2723612 GGCACTGAGCAAGCCGGGGCTGG + Intronic
1161289124 19:3483391-3483413 GGCGGACACCATGCCGGGGCTGG - Intergenic
1161496844 19:4591206-4591228 GTCGCAGAGCAGGCTGGGGACGG - Intergenic
1163371390 19:16903235-16903257 GCCCCAGACCAGGCTGGGGCAGG - Intronic
1164302228 19:23972375-23972397 TCCGCAGAGCAGGGCGCGGCAGG + Intergenic
1165242759 19:34481373-34481395 GCCGGAGAGCAAGGCGGCGCAGG + Intergenic
1165319754 19:35077829-35077851 GCAGCAGAGCACACCTGGGCTGG + Intergenic
1165792120 19:38499016-38499038 GCCGCAGGGCAGGGCAGGGCAGG + Intronic
1165879437 19:39032057-39032079 GCCGCCAAGTGTGCCGGGGCTGG - Exonic
1165950952 19:39473661-39473683 GAGGCATAGCATGGCGGGGCGGG + Intronic
1166691469 19:44823798-44823820 GCTGCAGAGCAAGCTGAGGCAGG - Intergenic
1202710514 1_KI270714v1_random:17154-17176 GCTTCAGAGCCTGCAGGGGCTGG + Intergenic
927571622 2:24165415-24165437 GCCTCAGAGCAGACAGGGGCTGG - Intronic
929530942 2:42752278-42752300 GCCTCAGAGCATGCCAAGGAAGG - Intronic
932599360 2:73113064-73113086 GCCGCAGACCAGCCCGGAGCGGG + Intronic
932616250 2:73233448-73233470 CCCGGAGAGTATGCTGGGGCGGG - Intronic
932798106 2:74715404-74715426 GGCTCAGGGCAGGCCGGGGCGGG + Intergenic
934290364 2:91686261-91686283 GCCGCAGTGCAGCCCGGCGCCGG - Intergenic
936012453 2:108933734-108933756 GCAACAGAGCAAGCTGGGGCAGG + Intronic
936464136 2:112732304-112732326 GTCCCAGAGCCTGCAGGGGCAGG + Intronic
936530495 2:113273245-113273267 GCCGGAGAGGATGCTGGAGCAGG + Intronic
937987702 2:127645907-127645929 GACTCAGAGCAGGCGGGGGCTGG - Exonic
938727283 2:134120119-134120141 GCCGCCGAGCGGGCCGCGGCAGG - Intronic
940640841 2:156342694-156342716 CCCGCAGGGCGGGCCGGGGCGGG - Intergenic
941230401 2:162904732-162904754 GCCACAGAGCAGGCCATGGCAGG + Intergenic
941651163 2:168094088-168094110 GGCGCACAGCATGCTGGGGAGGG - Intronic
943092291 2:183389782-183389804 GCAGCACAGCTTGCAGGGGCCGG + Intergenic
948653969 2:239465365-239465387 GGCACAGAGCAAGCCGGGGAAGG - Intergenic
948908148 2:240989587-240989609 GCCGCACAGAATCCCAGGGCAGG - Intronic
948983871 2:241508464-241508486 GCTGCAGAGCGGGCCGGGGGAGG - Exonic
1168837996 20:890476-890498 GGCTCAGAACATGCCGGGCCAGG + Intronic
1172775031 20:37402359-37402381 GCCACAGAGCACTCTGGGGCTGG - Intronic
1174379426 20:50147061-50147083 GCCCCACAGCATGCAGGGACAGG + Intronic
1174493851 20:50924499-50924521 GCCACAGAGTATGTCTGGGCTGG - Intronic
1175518757 20:59586136-59586158 ACCACAGAGCAGGCCAGGGCAGG - Intronic
1175753524 20:61515186-61515208 GCAGCAGGGCCTGCCGGTGCTGG - Intronic
1176011313 20:62897854-62897876 GGTGCACCGCATGCCGGGGCAGG + Intronic
1178685182 21:34705148-34705170 GCTGCAGAGCAAGTCGGGACTGG + Intronic
1179724348 21:43333502-43333524 TCCTCAGGGCAGGCCGGGGCTGG + Intergenic
1179909103 21:44438633-44438655 GCCGCAGCACAGGCCGGGGTGGG + Intronic
1180216110 21:46324586-46324608 GGCGCGGTGCACGCCGGGGCGGG + Intronic
1181299260 22:21867685-21867707 GCCGAGGAGGGTGCCGGGGCGGG + Intergenic
1181556054 22:23672239-23672261 ACTGCTGAGCAGGCCGGGGCAGG - Intergenic
1181626739 22:24127270-24127292 GCCGCGGTGCCTGTCGGGGCTGG + Intronic
1181698325 22:24606414-24606436 ACTGCTGAGCAGGCCGGGGCAGG + Intronic
1183353979 22:37348820-37348842 GCAGCAGAGCATGAGGGGTCGGG + Intergenic
1183386664 22:37519151-37519173 GCCGAGGAGGAGGCCGGGGCCGG - Exonic
1183986169 22:41571864-41571886 GCCGCAGAGCAGGGCCAGGCCGG + Exonic
1184473979 22:44710876-44710898 GCCGCAGGGCAGGGCAGGGCAGG + Intronic
1184677729 22:46052884-46052906 GCCGCAGAGCCTCCCCAGGCAGG + Intronic
1184782982 22:46658366-46658388 GCAGCAGAGGACGGCGGGGCGGG - Intronic
1185373503 22:50471511-50471533 GCAGCAGAGCCGGCCAGGGCTGG - Intronic
953232396 3:41076554-41076576 GAAGCAGAGCATGGCAGGGCAGG + Intergenic
954806739 3:53224983-53225005 ACAGCAGAGCAGGTCGGGGCTGG + Intronic
961393737 3:126571613-126571635 GCCGCAGTGCGTGGTGGGGCAGG - Intergenic
961551583 3:127672926-127672948 GCTGCAGAGCGGGGCGGGGCGGG + Exonic
961558103 3:127710484-127710506 GCAGCAGAGAATGCCAAGGCTGG + Intronic
962804252 3:138915714-138915736 GGCGCAGCGCAGGGCGGGGCAGG + Intergenic
964344658 3:155744219-155744241 GGCGCAGAGCGTGCCGCCGCGGG + Intronic
967859795 3:194141868-194141890 GCGGCAGGCCACGCCGGGGCAGG + Intergenic
968591127 4:1460153-1460175 TCCCCAGAGCAGGGCGGGGCTGG - Intergenic
969151001 4:5168403-5168425 GCTGCAGATCATGCAAGGGCTGG + Exonic
969191689 4:5526509-5526531 GCAGCAGGGCATACAGGGGCTGG - Intronic
969201273 4:5608241-5608263 GCTGCAGAGTATGCTGGGACTGG - Intronic
969420507 4:7091702-7091724 ATCACAGAGCATGCTGGGGCAGG + Intergenic
969595963 4:8149431-8149453 GCTGCAGAGCAGGCAGGAGCAGG + Intronic
969637081 4:8375462-8375484 GCCGCAGAGCATCCCGAGGCCGG - Intronic
975850503 4:78567022-78567044 GCTGCAGAGCATGCCTGCGGTGG + Intronic
978072605 4:104491485-104491507 GCCCCAGAGCATGGCGGTGGCGG + Exonic
985070042 4:186158662-186158684 GCAGCAGTGCGTGCAGGGGCTGG - Intronic
985073452 4:186191046-186191068 CCCGGAGAGCACGCAGGGGCGGG - Intergenic
989215967 5:38904960-38904982 GCCACAGAGCATGCTGGAGAGGG - Intronic
993796036 5:92268506-92268528 GCCGCACAGCTTGCAGGGACAGG - Intergenic
996862572 5:128083369-128083391 GCCGCAGAGCGCGGCGGGGGAGG + Intergenic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
1001172567 5:169434427-169434449 GCAGCAGAGCTTGGCGGGGTAGG + Intergenic
1002062009 5:176630612-176630634 GCCGATGAGCCTCCCGGGGCGGG + Intergenic
1002927867 6:1615098-1615120 GCCGCAGCGCCGGCCCGGGCAGG - Intergenic
1005677580 6:28171132-28171154 GCCTAAGAGCATGGCTGGGCCGG - Intergenic
1006440838 6:34052701-34052723 ACCACAGAGCATGCCTGGGCTGG + Intronic
1006903364 6:37516951-37516973 GCCACAGGGCATGCCTGGACCGG - Intergenic
1007827319 6:44610318-44610340 GCAGGGGAGCAGGCCGGGGCTGG - Intergenic
1008544979 6:52576571-52576593 GCGGCAGAGCATGGCATGGCTGG + Intronic
1010559540 6:77333073-77333095 TCCGCAGAGCCAGCAGGGGCTGG + Intergenic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1017201507 6:151759616-151759638 GCTGCAGGGCATGCTGGGGAAGG - Intronic
1018789261 6:167134045-167134067 GCTGCAGAGCATGGCAGGGGTGG - Intronic
1018826879 6:167415233-167415255 GCAGCAGAGTATGGCTGGGCCGG - Intergenic
1019288557 7:235913-235935 GCAGCAGAGCGTACCGTGGCTGG - Intronic
1019415164 7:923703-923725 GCCGCAGGGCATGGCGTGGGGGG + Intronic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019504734 7:1385256-1385278 GGGGCAGGGCAGGCCGGGGCGGG + Intergenic
1019712872 7:2525369-2525391 GGGGGAGGGCATGCCGGGGCGGG - Intronic
1020468355 7:8506878-8506900 GCTGCAGGGCATGCAGGGTCTGG - Intronic
1024199087 7:47088407-47088429 GCAGCTCAGCATGCCGGGGAAGG + Intergenic
1024711208 7:52016920-52016942 GCAGCAGTGCATGCCTGGGATGG + Intergenic
1027059415 7:75073674-75073696 GCGGCTGAGCGGGCCGGGGCTGG - Exonic
1027138237 7:75639297-75639319 GCCGCAGCGCGCGCCGGGGGCGG + Intronic
1028198481 7:87934335-87934357 GCCGCAGCACCGGCCGGGGCTGG + Intronic
1032266658 7:130374436-130374458 GCCGCAGAGCTTGGCAGAGCTGG - Intergenic
1032403030 7:131637093-131637115 ACCACAGGGCATGCCTGGGCTGG + Intergenic
1033226500 7:139567205-139567227 GGCGTAGAGCACGCGGGGGCTGG - Exonic
1037768960 8:21787990-21788012 GCCGCGGAGCTAGCCGGGCCCGG - Intronic
1037807406 8:22066411-22066433 GCCGCAGGCCGGGCCGGGGCGGG + Intronic
1038633039 8:29263229-29263251 GCCGCAGCGAAGGCGGGGGCGGG + Intergenic
1049241543 8:141539978-141540000 GCGAGAGAGCATGCCGGGGACGG - Intergenic
1049713585 8:144078719-144078741 GCCGGGCAGCATGGCGGGGCTGG + Exonic
1049752946 8:144294214-144294236 GCTGCAGAGCTTTCCGGCGCTGG + Intronic
1055000730 9:71446731-71446753 GCCGGAGCGCCAGCCGGGGCAGG - Intronic
1055611947 9:78032144-78032166 TCCGCAGAGCCCGCGGGGGCCGG - Intergenic
1057181781 9:93034560-93034582 GCCGCAGAGCAGGCTGGGCTGGG - Exonic
1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG + Exonic
1057802445 9:98198523-98198545 GCTGCAGCGCAAGCCAGGGCTGG - Intergenic
1059312731 9:113399801-113399823 GTGGCAGAGCCTGCCAGGGCTGG - Intronic
1059767999 9:117402176-117402198 GCTACAGAGGAGGCCGGGGCAGG - Intronic
1061012120 9:127961878-127961900 GGGGCGGAGGATGCCGGGGCAGG + Intronic
1061807667 9:133145385-133145407 GGCCCAGGCCATGCCGGGGCGGG - Intronic
1061866662 9:133494855-133494877 GACGCAGGGGAGGCCGGGGCTGG - Intergenic
1062594826 9:137294952-137294974 GCAGCAGAGGAGGCCGGCGCTGG - Intergenic
1062697035 9:137880790-137880812 CCCACAGAGCAGGCCGAGGCTGG + Intronic
1190258896 X:48785984-48786006 GCCCCAGGGCAGGCCGGAGCTGG + Intergenic
1190287234 X:48969796-48969818 GAGGCAGAGCAGGCCGGGGACGG - Exonic
1190691974 X:52919922-52919944 GCGGCAGAGAATGCCAGGGCAGG + Intergenic
1190694009 X:52935870-52935892 GCGGCAGAGAATGCCAGGGCAGG - Intronic
1191062890 X:56318312-56318334 GTAGCAGGGCATGCAGGGGCTGG - Intergenic
1198767076 X:140091283-140091305 GCCGCGGCGCAAGCGGGGGCTGG + Intergenic