ID: 1093737261

View in Genome Browser
Species Human (GRCh38)
Location 12:22635323-22635345
Sequence TGGTCTACACACACCCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093737261_1093737265 -1 Left 1093737261 12:22635323-22635345 CCAAGAAGGGTGTGTGTAGACCA 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1093737265 12:22635345-22635367 AGTTGTTGGCATCAGCTGCTGGG 0: 1
1: 0
2: 2
3: 26
4: 160
1093737261_1093737266 2 Left 1093737261 12:22635323-22635345 CCAAGAAGGGTGTGTGTAGACCA 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1093737266 12:22635348-22635370 TGTTGGCATCAGCTGCTGGGAGG 0: 1
1: 0
2: 0
3: 33
4: 254
1093737261_1093737264 -2 Left 1093737261 12:22635323-22635345 CCAAGAAGGGTGTGTGTAGACCA 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1093737264 12:22635344-22635366 CAGTTGTTGGCATCAGCTGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189
1093737261_1093737267 18 Left 1093737261 12:22635323-22635345 CCAAGAAGGGTGTGTGTAGACCA 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1093737267 12:22635364-22635386 TGGGAGGAACTTGCTCACCATGG 0: 1
1: 0
2: 1
3: 19
4: 143
1093737261_1093737268 19 Left 1093737261 12:22635323-22635345 CCAAGAAGGGTGTGTGTAGACCA 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1093737268 12:22635365-22635387 GGGAGGAACTTGCTCACCATGGG 0: 1
1: 0
2: 1
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093737261 Original CRISPR TGGTCTACACACACCCTTCT TGG (reversed) Intronic
901534522 1:9873560-9873582 TGGACTCCACACAGCCTTGTGGG + Intronic
902553644 1:17233987-17234009 TGTTCTACCCACACCCTTGGGGG + Intronic
904843405 1:33389296-33389318 TGTTCAACACACATTCTTCTTGG + Intronic
905036695 1:34923340-34923362 TGGTCTACCCTCTCCCTTGTAGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
909743086 1:79056463-79056485 TGGTCTAAACACAAGCTTCGGGG + Intergenic
911642600 1:100304844-100304866 TGGTCCACACAGACCCTTTAAGG + Intergenic
919763767 1:201113915-201113937 TTGTCTACCCTCACCCTTCCTGG - Intergenic
923447392 1:234085114-234085136 TGTTCTAGACTCTCCCTTCTAGG - Intronic
924167769 1:241303026-241303048 TGGTGTATACACTCCCTTCATGG - Intronic
1066535706 10:36389268-36389290 TGGTACACACACATCCTTTTAGG + Intergenic
1068447832 10:57146269-57146291 TGGTCTACATGCTCCCTTCTTGG - Intergenic
1073334879 10:102699142-102699164 TGTTGTACCCACACCCATCTTGG - Intronic
1074502900 10:114043199-114043221 GGTTTTACACACACCCTGCTAGG + Intergenic
1075441712 10:122485005-122485027 TGGTCTACAGACACCCTGGCTGG - Intronic
1083738910 11:64697443-64697465 TTGTCTACCCACTCACTTCTGGG + Intronic
1091255076 11:134176535-134176557 TGTTCTGCACATACACTTCTCGG - Intronic
1091991441 12:4959271-4959293 TGTTCTACATCCACCCTCCTCGG + Intergenic
1093737261 12:22635323-22635345 TGGTCTACACACACCCTTCTTGG - Intronic
1098019892 12:66143451-66143473 TGGTGTACATACATCCTTCATGG + Intronic
1099295511 12:80823430-80823452 TGGTCCAGCCACAGCCTTCTAGG + Intronic
1100895527 12:99178265-99178287 TGGCCTACAGACACCCCTGTGGG - Intronic
1102204492 12:111081212-111081234 AGGTTTACAAACACCCCTCTGGG + Intronic
1103739282 12:123080586-123080608 TGGGCTACACACAGGCTTTTAGG - Intronic
1109198578 13:59406430-59406452 TGATCTAAACACCCCCTTTTAGG - Intergenic
1110203670 13:72884243-72884265 TGGTCTCTACACACCCTGATAGG + Intronic
1111572768 13:90108343-90108365 TGGCCTACACGCACCCCTGTCGG - Intergenic
1113802984 13:113096106-113096128 TGGTCTCCACACACAGCTCTCGG - Intronic
1119322671 14:73740930-73740952 AGGACTGCACACACCCTTCTGGG - Intronic
1120356887 14:83445471-83445493 TGGTATATAAACACACTTCTGGG - Intergenic
1121414101 14:93767130-93767152 TGGTCTGCCCACCCCCTTCAAGG - Intronic
1121915458 14:97833727-97833749 TGGTTTACACACACACCTCAGGG - Intergenic
1122003655 14:98684736-98684758 TGGTCTCCCCACACCCCTCCAGG - Intergenic
1125080494 15:35667314-35667336 TGGTCCTCAAAGACCCTTCTTGG + Intergenic
1128209731 15:65887857-65887879 TGGACTATACACAGCCTTCTAGG - Exonic
1131051972 15:89354329-89354351 TGGTCTCCACACACAGGTCTGGG + Intergenic
1132278818 15:100594581-100594603 TAATCTACACACATCCTCCTAGG + Intronic
1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG + Intronic
1139381886 16:66537661-66537683 TGGTCTAGACACACAAATCTGGG + Intronic
1143251116 17:5523781-5523803 TGGTCTTCATGGACCCTTCTGGG - Intronic
1146432122 17:32807623-32807645 TGGGATACACACACACTTCTGGG + Intronic
1150712753 17:67545799-67545821 TGGGCATCACACACCGTTCTAGG + Intronic
1159971724 18:74664094-74664116 TGGTCTTCTCACACACTACTTGG - Intronic
1160312484 18:77808881-77808903 TGCTCACCACACAGCCTTCTAGG - Intergenic
1163130840 19:15271948-15271970 TGGTGTGCACACACCAGTCTGGG + Intronic
1167625090 19:50582761-50582783 TGAACTACACACAGGCTTCTGGG - Intergenic
1168133065 19:54332956-54332978 TGGTATAAACACTCCCTTCATGG - Intergenic
1168161993 19:54516589-54516611 GAGTCTACACACACCCATTTAGG - Intergenic
927503638 2:23598896-23598918 TGCTCTACCCCCAGCCTTCTGGG - Intronic
928595412 2:32855246-32855268 CTGTCCACACACACCCTCCTGGG - Intergenic
929923343 2:46189237-46189259 TGTGCTAAACACATCCTTCTTGG - Intergenic
933626103 2:84601675-84601697 TGGTCTACACACACCTGTTAAGG - Intronic
936404902 2:112194211-112194233 TGTCCTACACACACTGTTCTAGG - Intergenic
940853478 2:158710205-158710227 TGTTCTATACATTCCCTTCTTGG + Intergenic
942778588 2:179613926-179613948 TGGTCTAAACGCTCCCTCCTTGG + Intronic
945961320 2:216138208-216138230 TTGACTACACACACTGTTCTTGG + Intronic
947288848 2:228548796-228548818 TGGACTTCACACACAGTTCTTGG - Intergenic
947492906 2:230611226-230611248 TTCTCCACACACACCCTTCAAGG + Intergenic
948249597 2:236515314-236515336 TGGTCTAGAAGCACTCTTCTGGG + Intergenic
948686280 2:239671651-239671673 TGGGCAACAGACACCCTGCTCGG - Intergenic
1169294447 20:4381687-4381709 TGATCTACACATAACATTCTTGG - Intergenic
1170319697 20:15081669-15081691 TGGTCTCTACTCACCCCTCTTGG - Intronic
1171190652 20:23156848-23156870 TGGTCTCCATACACCTTTCAGGG - Intergenic
1171305509 20:24102539-24102561 TGCTCTACACATCCCCTTCGTGG + Intergenic
1175931029 20:62493774-62493796 TGGTCCACCCTCACCCTGCTGGG - Intergenic
1177222323 21:18210199-18210221 TGGTCTAAACACTCCCTTTGTGG + Intronic
1179891425 21:44337277-44337299 AGGTCTACACCCCCTCTTCTTGG - Intronic
1180958739 22:19752780-19752802 CGGTCTACAGAGAACCTTCTGGG - Intergenic
949898475 3:8790453-8790475 TGGACTACAGACACCTTTCAAGG - Intronic
951387283 3:22058055-22058077 TTGGCTATACACACCCTTCTAGG + Intronic
953068779 3:39499327-39499349 TGGTCTATACATACCTGTCTGGG + Intronic
954704594 3:52472585-52472607 TGGTCTGCACACACCTTCCCTGG + Intronic
954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG + Intergenic
955794988 3:62626386-62626408 TGGTTTACACTCATCCTTTTGGG - Intronic
957178357 3:76842447-76842469 TTGTCTACACTCACAGTTCTTGG - Intronic
958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG + Intronic
959274383 3:104259228-104259250 TGGTCTATACTCACCCTTGGAGG + Intergenic
966313133 3:178616382-178616404 TGGTTTAAACACTCCCTCCTTGG + Intronic
968955926 4:3719380-3719402 CGGTCCACACACAGCCTGCTTGG - Intergenic
970405303 4:15757342-15757364 TGGTCTACCTCCACCCTCCTGGG - Intergenic
973662309 4:53120767-53120789 TGTTATACCAACACCCTTCTGGG - Intronic
978750988 4:112247231-112247253 TTGTCTACAGACAACCTTATTGG + Intronic
982719885 4:158848492-158848514 TTGTCTGTACCCACCCTTCTTGG - Intronic
983953000 4:173663815-173663837 TGGTAGGCACACACCCTTCTAGG + Intergenic
984978102 4:185248836-185248858 TGATCAACACCCACCCTTCATGG + Intronic
988608278 5:32701633-32701655 TTCTTTACACACATCCTTCTTGG + Intronic
994652296 5:102543843-102543865 TGGTCTACATACAACTTTCATGG - Intergenic
996961382 5:129254719-129254741 TTGTCTATACATATCCTTCTAGG + Intergenic
998368237 5:141644777-141644799 TGGCCTCCATAGACCCTTCTAGG - Intronic
998913760 5:146992646-146992668 TGGTTTACACAGACACTTCAGGG + Intronic
999721680 5:154403198-154403220 TGGCCTACACAGACCCTCCTTGG - Intronic
1000882230 5:166711596-166711618 TGGTTCACACACACTGTTCTTGG + Intergenic
1001781385 5:174371841-174371863 TTGTCTACAGACACCTTTGTGGG + Intergenic
1002441666 5:179267503-179267525 TGCTGTGCACACACCCTGCTGGG - Intronic
1005719869 6:28590397-28590419 TCGTCTACACACACAGTTCAGGG - Intronic
1006130363 6:31865435-31865457 TGGTCTAGACACCCCCATCCTGG - Intronic
1008521359 6:52364329-52364351 AGGTATACACACACCCTTAATGG - Intronic
1016054832 6:139567428-139567450 TGGTCTAAACACTCCCTCCATGG + Intergenic
1018024072 6:159790201-159790223 TGGTCCACACACACCCCACCTGG - Intronic
1018254313 6:161903275-161903297 TGGTGTAAATACACCCATCTGGG - Intronic
1019654889 7:2186737-2186759 TGGTCTGCAGACACCATTCTAGG + Intronic
1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG + Intronic
1024010085 7:45259709-45259731 TGGTTCACACCCACCCTTCCAGG + Intergenic
1024956657 7:54927569-54927591 TTGTTTACACCCACCCTTCTTGG - Intergenic
1025262650 7:57430153-57430175 TGGTCTCCACACTTCCTCCTTGG - Intergenic
1030846125 7:114414184-114414206 GGGTCCACACAAACCCTGCTAGG + Intronic
1034275605 7:149822507-149822529 TGCTCCACACACACTCCTCTAGG - Intergenic
1041540763 8:58982308-58982330 TGGCGTACACACCCTCTTCTTGG + Intronic
1045034741 8:98168347-98168369 TGGTGTACCCACGCCTTTCTGGG - Intergenic
1047642149 8:126832328-126832350 TCCCCTACACACACTCTTCTTGG - Intergenic
1050339153 9:4618627-4618649 GGGTCTACATACACCCTCCTTGG + Intronic
1055991045 9:82105965-82105987 TGGTCTACACATTCACCTCTGGG + Intergenic
1057189974 9:93081625-93081647 TGGGTTACACACACCGTGCTGGG + Intronic
1057304320 9:93903544-93903566 TGGGCTCCACACTCCCATCTTGG - Intergenic
1059746330 9:117205305-117205327 AGGTCTACACATACACATCTTGG + Intronic
1060091604 9:120748112-120748134 TGGTCTAATCACATCTTTCTAGG - Intergenic
1187835783 X:23430599-23430621 TGGTCTCCACTCTCCCTTCTTGG + Intergenic
1190146077 X:47892785-47892807 TGGTGTACACACATCCTCATGGG + Intronic
1192055228 X:67767160-67767182 AGGTCTACATGCACCCTCCTTGG + Intergenic
1192310558 X:70009885-70009907 TGATTTAAAAACACCCTTCTAGG - Intronic
1198702154 X:139408590-139408612 TGGTCTAGACAAAAACTTCTTGG - Intergenic