ID: 1093741774

View in Genome Browser
Species Human (GRCh38)
Location 12:22697096-22697118
Sequence CTGTCTCAGTGCAGCGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093741766_1093741774 19 Left 1093741766 12:22697054-22697076 CCATCTTTCTGCTTCGTCAGCTG 0: 1
1: 0
2: 1
3: 20
4: 324
Right 1093741774 12:22697096-22697118 CTGTCTCAGTGCAGCGCTCTAGG 0: 1
1: 0
2: 1
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093741774 Original CRISPR CTGTCTCAGTGCAGCGCTCT AGG Intergenic
900917869 1:5651064-5651086 CTGTCACAGGGCAGGGCTATGGG + Intergenic
901020475 1:6252730-6252752 CTGTCTCACTGCAGACCTTTCGG + Intronic
901502879 1:9664478-9664500 CTGTATCTGTGCAGGGCTTTGGG - Intronic
901910143 1:12450573-12450595 CTGTCGCAGTGCTGGGCACTAGG + Intronic
903132478 1:21289345-21289367 CTGTCCCAGTGCAGCCCCCCAGG + Intronic
904302267 1:29561913-29561935 CTGACCCAGTGCAGGGCCCTGGG + Intergenic
904811194 1:33164440-33164462 CAGGCTCAGTCCAGCACTCTGGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
907238730 1:53069016-53069038 CTTTCTCTGTGCTGGGCTCTGGG + Intronic
910663853 1:89702929-89702951 CTTTCTCTGTGCTGGGCTCTGGG - Intronic
910667775 1:89742848-89742870 CTCTCACAGTGGAGAGCTCTGGG - Intronic
913559981 1:120007939-120007961 CACTCACAGTGCAGCCCTCTGGG + Intronic
913685661 1:121229481-121229503 CTTTCTCAGAGCAGTGCTATTGG + Intronic
914037507 1:144017084-144017106 CTTTCTCAGAGCAGTGCTATTGG + Intergenic
914151947 1:145050848-145050870 CTTTCTCAGAGCAGTGCTATTGG - Intronic
914280566 1:146167358-146167380 CACTCACAGTGCAGCCCTCTGGG + Intronic
914541609 1:148618298-148618320 CACTCACAGTGCAGCCCTCTGGG + Intronic
914625030 1:149452949-149452971 CACTCACAGTGCAGCCCTCTGGG - Intergenic
916918685 1:169439113-169439135 CTGTCTCAGTTCAGCTCCTTTGG - Intronic
918165055 1:181937051-181937073 CTGTGTAAGTTCAGCTCTCTGGG + Intergenic
918343955 1:183590351-183590373 CTGTCTCCTGGCAGCTCTCTTGG - Exonic
920096597 1:203490463-203490485 CTGCCTCAGTACAGAGCTCCTGG - Exonic
920472982 1:206248038-206248060 CTTTCTCAGAGCAGTGCTATTGG + Intronic
924554390 1:245106266-245106288 CTGTCACAGTGAATCTCTCTGGG + Intronic
1063212162 10:3890657-3890679 CAGCCTCAGTGCAGGGCTGTAGG - Intergenic
1063506036 10:6600488-6600510 CCTTCTCAATGCAGCGCTCCTGG + Intergenic
1066688587 10:38004384-38004406 CTGTCTAATTGTAGCTCTCTGGG + Intergenic
1066708859 10:38211286-38211308 CAGTCTAAGTGCAGGTCTCTTGG - Intergenic
1066980637 10:42411204-42411226 CAGTCTAAGTGCAGGTCTCTTGG + Intergenic
1067227105 10:44383481-44383503 GTGTCACAGTGCGCCGCTCTGGG - Intronic
1067577827 10:47419215-47419237 CTGTCTGTCTGCAGCTCTCTGGG - Intergenic
1069721439 10:70552085-70552107 CTGCCTCAGTGCTGGGCCCTGGG + Intronic
1072082797 10:92048559-92048581 ATGTCACAGTGCAGTTCTCTAGG - Intronic
1075754769 10:124801947-124801969 CTGTCTCAGGCCGGCGCTCGCGG + Intronic
1076033333 10:127177606-127177628 CTGTTTCTGTGCAGCTCTCACGG - Intronic
1076939396 10:133591441-133591463 CTGTCCAAGTGCAGTGATCTGGG - Intergenic
1076946997 10:133658320-133658342 CTGTGTCAGCACAGGGCTCTGGG - Intergenic
1077354420 11:2108657-2108679 CTGTCTCACTGAAGAGCTCCAGG - Intergenic
1081990496 11:47334919-47334941 CTGTCTCTGCCCAGCGTTCTGGG + Intronic
1082812721 11:57488376-57488398 CAGCCTCACTGCAGCGGTCTCGG - Intronic
1083788955 11:64971725-64971747 CTTTCTCAGCGCCGGGCTCTCGG - Intronic
1084727683 11:70952691-70952713 CTGCTTCAGGGCAGCACTCTGGG + Intronic
1085006713 11:73098651-73098673 CTTTCTCAGTTTAGTGCTCTTGG - Intronic
1085282476 11:75340298-75340320 CTTCCTCAGTGCAGGCCTCTGGG - Intronic
1085722280 11:78923171-78923193 CCCTCTGAGTGCAGGGCTCTGGG - Intronic
1091665016 12:2412474-2412496 CTGTCTCACTGCTGGGCTCCTGG - Intronic
1092118152 12:6024235-6024257 CTGCCTCACTGCAGTGCTATGGG + Intronic
1093741774 12:22697096-22697118 CTGTCTCAGTGCAGCGCTCTAGG + Intergenic
1095253987 12:40011895-40011917 CCTTCTGAGTGCAGGGCTCTGGG + Intronic
1096004462 12:48157695-48157717 CAGGCTCAGTGCAGCGTTCTCGG + Intronic
1097804081 12:63945873-63945895 CAGTCTCAGAGCAGTGATCTGGG + Intronic
1100590952 12:96028626-96028648 CTGTTACAGTGCAGCAATCTTGG - Intronic
1103390014 12:120565483-120565505 CTATCTCAATCCTGCGCTCTCGG - Exonic
1105826324 13:24126565-24126587 CTGTCTCTGTCCTGCGCCCTGGG - Intronic
1106598651 13:31168877-31168899 CTGGCTTAGTGCAGGGCACTGGG - Intergenic
1109618332 13:64866546-64866568 CTGTGTCTGTGCAAAGCTCTTGG + Intergenic
1110005873 13:70267819-70267841 ATTTTTCAGTGCAGTGCTCTGGG - Intergenic
1110160772 13:72375778-72375800 CTTTCTCAGTGCAGCCTTCTTGG - Intergenic
1111562346 13:89967612-89967634 CTGTCTCAGACTAGCGCTTTAGG - Intergenic
1119670331 14:76513606-76513628 CTGCCTCAGTACGGAGCTCTGGG + Intergenic
1119776549 14:77252743-77252765 CTGTCTGTGTCCAGGGCTCTGGG + Intronic
1120684676 14:87524539-87524561 CTGGCTCAGTGCAGACCACTAGG + Intergenic
1121947292 14:98135781-98135803 ATCTCTCTGTGCAGCGTTCTGGG + Intergenic
1122016618 14:98802147-98802169 CTATCTCCCTGCAGGGCTCTGGG - Intergenic
1122848754 14:104515315-104515337 CTGGCCCAGTGCAGGGGTCTCGG - Intronic
1202921063 14_KI270723v1_random:30869-30891 CTGTGTCAGCACAGGGCTCTCGG - Intergenic
1202923849 14_KI270724v1_random:6705-6727 CTGTGTCAGCACAGGGCTCTGGG + Intergenic
1130963182 15:88678516-88678538 CTGTCTCAGTGGCGTGATCTCGG - Intergenic
1132739824 16:1406144-1406166 CTGTTTCAGTGCTGTGCTCTGGG - Intronic
1133250489 16:4477107-4477129 CTTTCTGAGCGCAGTGCTCTGGG + Intronic
1134893161 16:17859523-17859545 CTTTCTGAGTTCAGCGCTCTTGG + Intergenic
1137983818 16:53091256-53091278 CTGTCTGACTCCAGCGTTCTTGG - Intronic
1138681244 16:58684862-58684884 CTGGCTCAGGGCAGTGCTGTCGG - Intronic
1140300035 16:73748690-73748712 CTGTCTCATTGAAGAGCCCTTGG + Intergenic
1144678963 17:17180193-17180215 CTGGCTCAGTGCTGGGCCCTGGG - Intronic
1146674955 17:34767043-34767065 CTGTCTCAGTGCTGCCCAGTTGG - Intergenic
1146926664 17:36750382-36750404 CTGTCTCGATGGAGGGCTCTGGG - Intergenic
1147111629 17:38266570-38266592 CTGTCGCAGTGGTGCGATCTTGG + Intergenic
1148417944 17:47522229-47522251 CTGTCGCAGTGGTGCGATCTTGG - Intergenic
1148558241 17:48591307-48591329 CTGTCTCAGTGATTCGCTTTTGG - Exonic
1148777387 17:50103247-50103269 CGGGCTCTGTGCAGAGCTCTGGG + Intronic
1148955835 17:51352972-51352994 ATGTCTCAGAGCAGCTCTGTGGG + Intergenic
1148983963 17:51604771-51604793 CTGTGTCAATGCAGTGCTCCAGG - Intergenic
1149059073 17:52400440-52400462 CTGTCTCATTGCAGACTTCTTGG + Intergenic
1151516460 17:74599273-74599295 CTGACTCAGTGCTCCTCTCTAGG - Intergenic
1155073843 18:22338436-22338458 CTGTCTCTGTGCCTCTCTCTGGG - Intergenic
1156889550 18:42174980-42175002 CTGTCTCAGAGGAGAGATCTTGG - Intergenic
1160037078 18:75311193-75311215 CTGGCTCACTTCAGCGCTTTTGG + Intergenic
1160162438 18:76483872-76483894 CTGTCACATGGCAGCGCTCAAGG - Intronic
1160190592 18:76711368-76711390 CTGTCTCAGGTCAGTGCCCTGGG + Intergenic
1162984647 19:14261762-14261784 CTTTCTCAGGACAGGGCTCTGGG + Intergenic
1165738124 19:38190254-38190276 GTGACTCAGTGCAGGGCTCATGG - Intronic
924958429 2:11427-11449 CTGTCTCTGTGCCGCGCCCCCGG - Intergenic
924969441 2:111705-111727 CTGTCACAGTGCAGGGATCCTGG - Intergenic
926700372 2:15799444-15799466 CTCTCTCAGTGCAGGGCTCTGGG + Intergenic
927503287 2:23596370-23596392 CTGTCTCCGAGCAGAGGTCTTGG + Intronic
929341919 2:40830199-40830221 CTGTCCCAGTGCAGCACTAGAGG + Intergenic
936694656 2:114931483-114931505 CTGGCTCAGTGCAGTCCTCATGG - Intronic
937459070 2:122069917-122069939 CTGTCCCTGTGCAGCGCGCTGGG + Intergenic
938161218 2:128986370-128986392 CTGTCTGAGTTCAGCTCTCGGGG - Intergenic
940421708 2:153486519-153486541 CTGACTCAGTGCAGCCAACTGGG - Intergenic
941949985 2:171145255-171145277 CTGTCGCAGTGGTGCGATCTCGG - Intronic
944738414 2:202589260-202589282 CCGTTTCAGTGGAGGGCTCTGGG - Intergenic
945275919 2:207987497-207987519 CTTTCTCAGTGCAGAGTTCCAGG - Intronic
947349800 2:229231592-229231614 CTGTATCAGTGGAGTGATCTTGG - Intronic
947606820 2:231491511-231491533 CAGCCTCAGTGCAGAGGTCTTGG - Intergenic
948001461 2:234571243-234571265 CAGGCTCACTGCAGCGCTCCTGG - Intergenic
948393648 2:237629137-237629159 CTGGCTCTGTGCTGAGCTCTTGG - Intronic
1172094630 20:32454613-32454635 CTGCCTCGGGGCACCGCTCTGGG + Intronic
1173188237 20:40857464-40857486 CTCTCTCACTCCAGCCCTCTAGG + Intergenic
1176083957 20:63287473-63287495 CTGTCCAGGTGCAGAGCTCTCGG + Intronic
1177505896 21:22016699-22016721 CTGTCTTAGTGCTGCACTCAGGG - Intergenic
1180181125 21:46119137-46119159 CTGCCTCAGGGCCCCGCTCTGGG + Intronic
1180569584 22:16702652-16702674 CTGCCTCACTGCAGTGCTATGGG + Intergenic
1181166714 22:20987843-20987865 CTGCCTCTGTGCTGGGCTCTGGG - Intronic
1181391758 22:22588178-22588200 GGGTCTCAAGGCAGCGCTCTCGG + Intergenic
1184357876 22:43994643-43994665 CTGTCTTGGTGCAGGGCTCCTGG - Intronic
1184546972 22:45177183-45177205 CTGTCTCAATGCAGTACTCTGGG - Intronic
953561665 3:43997323-43997345 CTGTCTGCGTGCTGTGCTCTGGG + Intergenic
954641983 3:52106142-52106164 CTGTCACAGTGGCGCGATCTCGG - Intronic
954800298 3:53183334-53183356 CTCTCCCAGTGGAGCTCTCTTGG + Intronic
956302453 3:67787259-67787281 CTATCTCAATGCAGCACTCCAGG - Intergenic
956702133 3:71967686-71967708 CTGTCTGATTGCAGAGCTCAAGG - Intergenic
957080465 3:75632096-75632118 CTGTGTCAGCACAGGGCTCTGGG + Intergenic
958953273 3:100439395-100439417 ATGTCTCATTCCAGCTCTCTTGG + Intronic
964282786 3:155085422-155085444 ATGTCTCAGTGCACCTCACTAGG + Intronic
977371627 4:96144566-96144588 CCTTTTCAGTGCAGCCCTCTTGG + Intergenic
982173564 4:152684065-152684087 GGGACACAGTGCAGCGCTCTGGG + Intergenic
985450455 4:190059119-190059141 CTGTGTCAGCACAGGGCTCTGGG - Intergenic
985794615 5:1952888-1952910 GTGTCTCAGTGCAGCTGGCTGGG + Intergenic
988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG + Intronic
993437532 5:87916178-87916200 CTGCCTCAGTGCTGAGCTGTTGG + Intergenic
993607498 5:90011410-90011432 CTGTCTCAATGCATCCCTTTAGG + Intergenic
999024029 5:148205218-148205240 CTCTCTCATTGCAGTGCTCTTGG + Intronic
999833492 5:155342954-155342976 CTGTTTCAGGACAGCCCTCTGGG + Intergenic
1001375095 5:171248790-171248812 CTGGGTGAGTGCAGCTCTCTGGG - Intronic
1001892539 5:175351337-175351359 CTCTGTCACTGCAGCTCTCTGGG + Intergenic
1006034651 6:31202114-31202136 CTGCCTCAGTGCAGAGCCCTGGG - Intronic
1006704466 6:36006644-36006666 CTGTCTCATTGCAGCACCATAGG + Intronic
1006843659 6:37048156-37048178 CAGTCTCCGTGCAGTGCTGTAGG + Intergenic
1011083369 6:83512535-83512557 CAGTCTCAGTGGCGAGCTCTGGG + Exonic
1012679041 6:102154720-102154742 CTGTCTCAGTGCAGTGATAGTGG + Intergenic
1015112569 6:129610137-129610159 CTATCTCAGTGCAGAGCTAAAGG + Intronic
1015356992 6:132289733-132289755 CTGTCTTTGTGCAGTGCACTTGG - Intergenic
1015925737 6:138308644-138308666 CTGTCTCAGTGGAACGTGCTGGG + Intronic
1016463295 6:144301379-144301401 CTGTCTCAGGGCAGCCTTGTTGG + Intronic
1017593154 6:155998603-155998625 CTGTCCCAGTGCAGACCACTGGG - Intergenic
1019034556 6:169043381-169043403 CAGGCTCAGTGCTGGGCTCTGGG + Intergenic
1019915114 7:4128201-4128223 TTGTCTCAGTGCTGCTCCCTGGG + Intronic
1025248798 7:57337921-57337943 CTGTCTCAGGTCAGGGCCCTGGG + Intergenic
1032070422 7:128802198-128802220 CTGTCTGAAAGCAGGGCTCTAGG - Intronic
1033226017 7:139563086-139563108 CTGACTCAGGGCAGCGCTGACGG + Exonic
1034522465 7:151631824-151631846 CGGGCTCAGGGCTGCGCTCTGGG + Intronic
1035100020 7:156388959-156388981 CTGCCTCAGTGGAGCGCTCAAGG - Intergenic
1042799415 8:72702596-72702618 CTGTCTCAGACCACCACTCTTGG + Intronic
1044455521 8:92388538-92388560 CTGCCCCAGTGCACCACTCTAGG - Intergenic
1045317025 8:101052230-101052252 CTTTCCCAGTGCACCCCTCTGGG + Intergenic
1046404484 8:113755177-113755199 TTGTATCAGTGCAGCGTTGTTGG - Intergenic
1047199325 8:122751411-122751433 CTGTCTCAGGGTACCCCTCTTGG + Intergenic
1047776585 8:128076376-128076398 TTGTCTCAGCTCAGAGCTCTGGG - Intergenic
1048151661 8:131900881-131900903 CTGTGTCAGTGCTCCTCTCTTGG - Intergenic
1049447842 8:142639629-142639651 CTGGCTCAGCCCAGCGCTCATGG + Intergenic
1049648094 8:143745799-143745821 ATGCCTCAGTGCAGCGATCATGG + Intergenic
1050145869 9:2566855-2566877 CTGTCTCAGTATATAGCTCTTGG - Intergenic
1056534281 9:87514359-87514381 CTGTCTCAGCCCAGACCTCTGGG - Intronic
1057645388 9:96869517-96869539 CAGTCTAAGTGCAGGTCTCTTGG - Intronic
1058820986 9:108728964-108728986 CCTGCTCAGTGCAGAGCTCTAGG + Intergenic
1060079659 9:120631051-120631073 ATGTTTCAGGGCAGTGCTCTGGG - Intronic
1062417251 9:136457885-136457907 TGGTCTCAGTGCCGTGCTCTTGG - Intronic
1192715222 X:73633499-73633521 ATGTCTCAGTGAAGACCTCTTGG + Intronic
1193902158 X:87194022-87194044 ATGTCTCAGTGTAGATCTCTGGG - Intergenic
1194193139 X:90861163-90861185 CAGTGTCACTGCAGCTCTCTAGG + Intergenic
1198442335 X:136675324-136675346 CGGTCCCAGTGTAGAGCTCTGGG - Intronic
1200539753 Y:4443613-4443635 CAGTGTCACTGCAGCTCTCTAGG + Intergenic
1201965900 Y:19735390-19735412 TTGTCTTAGTGCAGGGCTCTAGG + Exonic