ID: 1093742579

View in Genome Browser
Species Human (GRCh38)
Location 12:22705305-22705327
Sequence GAAAGCTGGCTAATATGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093742579_1093742587 25 Left 1093742579 12:22705305-22705327 CCATTTCATATTAGCCAGCTTTC No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data
1093742579_1093742582 -5 Left 1093742579 12:22705305-22705327 CCATTTCATATTAGCCAGCTTTC No data
Right 1093742582 12:22705323-22705345 CTTTCATCAGTGGCCACCCTAGG No data
1093742579_1093742583 -4 Left 1093742579 12:22705305-22705327 CCATTTCATATTAGCCAGCTTTC No data
Right 1093742583 12:22705324-22705346 TTTCATCAGTGGCCACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093742579 Original CRISPR GAAAGCTGGCTAATATGAAA TGG (reversed) Intergenic
No off target data available for this crispr