ID: 1093742581

View in Genome Browser
Species Human (GRCh38)
Location 12:22705319-22705341
Sequence GGGTGGCCACTGATGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093742581_1093742590 29 Left 1093742581 12:22705319-22705341 CCAGCTTTCATCAGTGGCCACCC No data
Right 1093742590 12:22705371-22705393 AGTGGTCACGTTAGCAGGGATGG No data
1093742581_1093742588 24 Left 1093742581 12:22705319-22705341 CCAGCTTTCATCAGTGGCCACCC No data
Right 1093742588 12:22705366-22705388 AATGAAGTGGTCACGTTAGCAGG No data
1093742581_1093742587 11 Left 1093742581 12:22705319-22705341 CCAGCTTTCATCAGTGGCCACCC No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data
1093742581_1093742589 25 Left 1093742581 12:22705319-22705341 CCAGCTTTCATCAGTGGCCACCC No data
Right 1093742589 12:22705367-22705389 ATGAAGTGGTCACGTTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093742581 Original CRISPR GGGTGGCCACTGATGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr