ID: 1093742585

View in Genome Browser
Species Human (GRCh38)
Location 12:22705339-22705361
Sequence TGCTCATCATGTTAGCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093742585_1093742591 12 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742591 12:22705374-22705396 GGTCACGTTAGCAGGGATGGAGG No data
1093742585_1093742587 -9 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data
1093742585_1093742592 23 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742592 12:22705385-22705407 CAGGGATGGAGGCTCTTTGTAGG No data
1093742585_1093742588 4 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742588 12:22705366-22705388 AATGAAGTGGTCACGTTAGCAGG No data
1093742585_1093742589 5 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742589 12:22705367-22705389 ATGAAGTGGTCACGTTAGCAGGG No data
1093742585_1093742590 9 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742590 12:22705371-22705393 AGTGGTCACGTTAGCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093742585 Original CRISPR TGCTCATCATGTTAGCCCTA GGG (reversed) Intergenic
No off target data available for this crispr