ID: 1093742587

View in Genome Browser
Species Human (GRCh38)
Location 12:22705353-22705375
Sequence TGATGAGCACATGAATGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093742584_1093742587 -6 Left 1093742584 12:22705336-22705358 CCACCCTAGGGCTAACATGATGA No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data
1093742581_1093742587 11 Left 1093742581 12:22705319-22705341 CCAGCTTTCATCAGTGGCCACCC No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data
1093742586_1093742587 -10 Left 1093742586 12:22705340-22705362 CCTAGGGCTAACATGATGAGCAC No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data
1093742579_1093742587 25 Left 1093742579 12:22705305-22705327 CCATTTCATATTAGCCAGCTTTC No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data
1093742585_1093742587 -9 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742587 12:22705353-22705375 TGATGAGCACATGAATGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093742587 Original CRISPR TGATGAGCACATGAATGAAG TGG Intergenic
No off target data available for this crispr