ID: 1093742589

View in Genome Browser
Species Human (GRCh38)
Location 12:22705367-22705389
Sequence ATGAAGTGGTCACGTTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093742585_1093742589 5 Left 1093742585 12:22705339-22705361 CCCTAGGGCTAACATGATGAGCA No data
Right 1093742589 12:22705367-22705389 ATGAAGTGGTCACGTTAGCAGGG No data
1093742586_1093742589 4 Left 1093742586 12:22705340-22705362 CCTAGGGCTAACATGATGAGCAC No data
Right 1093742589 12:22705367-22705389 ATGAAGTGGTCACGTTAGCAGGG No data
1093742584_1093742589 8 Left 1093742584 12:22705336-22705358 CCACCCTAGGGCTAACATGATGA No data
Right 1093742589 12:22705367-22705389 ATGAAGTGGTCACGTTAGCAGGG No data
1093742581_1093742589 25 Left 1093742581 12:22705319-22705341 CCAGCTTTCATCAGTGGCCACCC No data
Right 1093742589 12:22705367-22705389 ATGAAGTGGTCACGTTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093742589 Original CRISPR ATGAAGTGGTCACGTTAGCA GGG Intergenic
No off target data available for this crispr