ID: 1093744435

View in Genome Browser
Species Human (GRCh38)
Location 12:22723623-22723645
Sequence AGTGTCTAAGTGGGTATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093744435_1093744443 -10 Left 1093744435 12:22723623-22723645 CCTTCTATACCCACTTAGACACT No data
Right 1093744443 12:22723636-22723658 CTTAGACACTGGGAGATAGGGGG No data
1093744435_1093744448 20 Left 1093744435 12:22723623-22723645 CCTTCTATACCCACTTAGACACT No data
Right 1093744448 12:22723666-22723688 AATGGCATTTTATTGTACCCAGG No data
1093744435_1093744447 2 Left 1093744435 12:22723623-22723645 CCTTCTATACCCACTTAGACACT No data
Right 1093744447 12:22723648-22723670 GAGATAGGGGGACTGGGGAATGG No data
1093744435_1093744445 -4 Left 1093744435 12:22723623-22723645 CCTTCTATACCCACTTAGACACT No data
Right 1093744445 12:22723642-22723664 CACTGGGAGATAGGGGGACTGGG No data
1093744435_1093744444 -5 Left 1093744435 12:22723623-22723645 CCTTCTATACCCACTTAGACACT No data
Right 1093744444 12:22723641-22723663 ACACTGGGAGATAGGGGGACTGG No data
1093744435_1093744446 -3 Left 1093744435 12:22723623-22723645 CCTTCTATACCCACTTAGACACT No data
Right 1093744446 12:22723643-22723665 ACTGGGAGATAGGGGGACTGGGG No data
1093744435_1093744449 27 Left 1093744435 12:22723623-22723645 CCTTCTATACCCACTTAGACACT No data
Right 1093744449 12:22723673-22723695 TTTTATTGTACCCAGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093744435 Original CRISPR AGTGTCTAAGTGGGTATAGA AGG (reversed) Intergenic
No off target data available for this crispr