ID: 1093745623

View in Genome Browser
Species Human (GRCh38)
Location 12:22737618-22737640
Sequence ATCCATGTGAAGCTACTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093745623_1093745627 22 Left 1093745623 12:22737618-22737640 CCAGGGAGTAGCTTCACATGGAT No data
Right 1093745627 12:22737663-22737685 CATAATCTTTTACAGTATCTGGG No data
1093745623_1093745626 21 Left 1093745623 12:22737618-22737640 CCAGGGAGTAGCTTCACATGGAT No data
Right 1093745626 12:22737662-22737684 TCATAATCTTTTACAGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093745623 Original CRISPR ATCCATGTGAAGCTACTCCC TGG (reversed) Intergenic
No off target data available for this crispr