ID: 1093745627

View in Genome Browser
Species Human (GRCh38)
Location 12:22737663-22737685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093745623_1093745627 22 Left 1093745623 12:22737618-22737640 CCAGGGAGTAGCTTCACATGGAT No data
Right 1093745627 12:22737663-22737685 CATAATCTTTTACAGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093745627 Original CRISPR CATAATCTTTTACAGTATCT GGG Intergenic
No off target data available for this crispr