ID: 1093746200

View in Genome Browser
Species Human (GRCh38)
Location 12:22743507-22743529
Sequence ATGCAACAACAGCATTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093746200_1093746204 21 Left 1093746200 12:22743507-22743529 CCATTTCAATGCTGTTGTTGCAT No data
Right 1093746204 12:22743551-22743573 GTAGTATTCTCAGGCCCAATTGG No data
1093746200_1093746205 26 Left 1093746200 12:22743507-22743529 CCATTTCAATGCTGTTGTTGCAT No data
Right 1093746205 12:22743556-22743578 ATTCTCAGGCCCAATTGGAAAGG No data
1093746200_1093746203 12 Left 1093746200 12:22743507-22743529 CCATTTCAATGCTGTTGTTGCAT No data
Right 1093746203 12:22743542-22743564 CCTCTAGAAGTAGTATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093746200 Original CRISPR ATGCAACAACAGCATTGAAA TGG (reversed) Intergenic
No off target data available for this crispr