ID: 1093746203

View in Genome Browser
Species Human (GRCh38)
Location 12:22743542-22743564
Sequence CCTCTAGAAGTAGTATTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093746198_1093746203 30 Left 1093746198 12:22743489-22743511 CCTCTTTCCACTTCTTTTCCATT No data
Right 1093746203 12:22743542-22743564 CCTCTAGAAGTAGTATTCTCAGG No data
1093746200_1093746203 12 Left 1093746200 12:22743507-22743529 CCATTTCAATGCTGTTGTTGCAT No data
Right 1093746203 12:22743542-22743564 CCTCTAGAAGTAGTATTCTCAGG No data
1093746199_1093746203 23 Left 1093746199 12:22743496-22743518 CCACTTCTTTTCCATTTCAATGC No data
Right 1093746203 12:22743542-22743564 CCTCTAGAAGTAGTATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093746203 Original CRISPR CCTCTAGAAGTAGTATTCTC AGG Intergenic
No off target data available for this crispr