ID: 1093746204

View in Genome Browser
Species Human (GRCh38)
Location 12:22743551-22743573
Sequence GTAGTATTCTCAGGCCCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093746200_1093746204 21 Left 1093746200 12:22743507-22743529 CCATTTCAATGCTGTTGTTGCAT No data
Right 1093746204 12:22743551-22743573 GTAGTATTCTCAGGCCCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093746204 Original CRISPR GTAGTATTCTCAGGCCCAAT TGG Intergenic
No off target data available for this crispr