ID: 1093749674

View in Genome Browser
Species Human (GRCh38)
Location 12:22783658-22783680
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093749672_1093749674 26 Left 1093749672 12:22783609-22783631 CCAATTACTTACTAATTAGTGAG No data
Right 1093749674 12:22783658-22783680 CACTGTAGATAATCAGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093749674 Original CRISPR CACTGTAGATAATCAGCTCA CGG Intergenic