ID: 1093764502

View in Genome Browser
Species Human (GRCh38)
Location 12:22947386-22947408
Sequence CTGGTCACAGGAGCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093764497_1093764502 7 Left 1093764497 12:22947356-22947378 CCTCTATACTTCTTTGACTTGGG No data
Right 1093764502 12:22947386-22947408 CTGGTCACAGGAGCCTTTGTGGG No data
1093764495_1093764502 11 Left 1093764495 12:22947352-22947374 CCAGCCTCTATACTTCTTTGACT No data
Right 1093764502 12:22947386-22947408 CTGGTCACAGGAGCCTTTGTGGG No data
1093764494_1093764502 18 Left 1093764494 12:22947345-22947367 CCAAGTGCCAGCCTCTATACTTC No data
Right 1093764502 12:22947386-22947408 CTGGTCACAGGAGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093764502 Original CRISPR CTGGTCACAGGAGCCTTTGT GGG Intergenic
No off target data available for this crispr