ID: 1093765082

View in Genome Browser
Species Human (GRCh38)
Location 12:22953131-22953153
Sequence AGATGCTGGCTGCAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093765082_1093765089 -1 Left 1093765082 12:22953131-22953153 CCTCCCCACTGCAGCCAGCATCT No data
Right 1093765089 12:22953153-22953175 TTGGCAGTGGTCACTCCAGATGG No data
1093765082_1093765090 0 Left 1093765082 12:22953131-22953153 CCTCCCCACTGCAGCCAGCATCT No data
Right 1093765090 12:22953154-22953176 TGGCAGTGGTCACTCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093765082 Original CRISPR AGATGCTGGCTGCAGTGGGG AGG (reversed) Intergenic
No off target data available for this crispr