ID: 1093773897

View in Genome Browser
Species Human (GRCh38)
Location 12:23049917-23049939
Sequence TTGAACAAAAATGAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093773892_1093773897 27 Left 1093773892 12:23049867-23049889 CCATTCTCACTCATGTAGGCAAG No data
Right 1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG No data
1093773893_1093773897 -2 Left 1093773893 12:23049896-23049918 CCAATATGTTGAGAGCCCAGATT No data
Right 1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093773897 Original CRISPR TTGAACAAAAATGAGAAGGA AGG Intergenic
No off target data available for this crispr