ID: 1093775015

View in Genome Browser
Species Human (GRCh38)
Location 12:23063705-23063727
Sequence TCAATTTTACACCTAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093775014_1093775015 3 Left 1093775014 12:23063679-23063701 CCTATCTTGTAAGGGCAGGGACT No data
Right 1093775015 12:23063705-23063727 TCAATTTTACACCTAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093775015 Original CRISPR TCAATTTTACACCTAGAGCC TGG Intergenic
No off target data available for this crispr