ID: 1093779046

View in Genome Browser
Species Human (GRCh38)
Location 12:23112844-23112866
Sequence CTTACTAAGCTTGAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093779042_1093779046 7 Left 1093779042 12:23112814-23112836 CCCAACTTCTTCATATTCTATTC No data
Right 1093779046 12:23112844-23112866 CTTACTAAGCTTGAGGTGAAGGG No data
1093779040_1093779046 13 Left 1093779040 12:23112808-23112830 CCACTCCCCAACTTCTTCATATT No data
Right 1093779046 12:23112844-23112866 CTTACTAAGCTTGAGGTGAAGGG No data
1093779043_1093779046 6 Left 1093779043 12:23112815-23112837 CCAACTTCTTCATATTCTATTCA No data
Right 1093779046 12:23112844-23112866 CTTACTAAGCTTGAGGTGAAGGG No data
1093779041_1093779046 8 Left 1093779041 12:23112813-23112835 CCCCAACTTCTTCATATTCTATT No data
Right 1093779046 12:23112844-23112866 CTTACTAAGCTTGAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093779046 Original CRISPR CTTACTAAGCTTGAGGTGAA GGG Intergenic
No off target data available for this crispr