ID: 1093779912

View in Genome Browser
Species Human (GRCh38)
Location 12:23123030-23123052
Sequence AGGTGGAAGTAGTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093779901_1093779912 22 Left 1093779901 12:23122985-23123007 CCAGGAGAGAGGCAAAGGTGGCT No data
Right 1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093779912 Original CRISPR AGGTGGAAGTAGTTGGATTC TGG Intergenic
No off target data available for this crispr