ID: 1093780142

View in Genome Browser
Species Human (GRCh38)
Location 12:23126058-23126080
Sequence CAGAGTCAACAGGAGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093780142_1093780146 30 Left 1093780142 12:23126058-23126080 CCACATTCCTCCTGTTGACTCTG No data
Right 1093780146 12:23126111-23126133 TTAACTTTGACAGTAGAGAAAGG No data
1093780142_1093780145 2 Left 1093780142 12:23126058-23126080 CCACATTCCTCCTGTTGACTCTG No data
Right 1093780145 12:23126083-23126105 GACTTGTAAACACAATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093780142 Original CRISPR CAGAGTCAACAGGAGGAATG TGG (reversed) Intergenic
No off target data available for this crispr