ID: 1093780145

View in Genome Browser
Species Human (GRCh38)
Location 12:23126083-23126105
Sequence GACTTGTAAACACAATCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093780144_1093780145 -8 Left 1093780144 12:23126068-23126090 CCTGTTGACTCTGTAGACTTGTA No data
Right 1093780145 12:23126083-23126105 GACTTGTAAACACAATCTTTAGG No data
1093780143_1093780145 -5 Left 1093780143 12:23126065-23126087 CCTCCTGTTGACTCTGTAGACTT No data
Right 1093780145 12:23126083-23126105 GACTTGTAAACACAATCTTTAGG No data
1093780142_1093780145 2 Left 1093780142 12:23126058-23126080 CCACATTCCTCCTGTTGACTCTG No data
Right 1093780145 12:23126083-23126105 GACTTGTAAACACAATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093780145 Original CRISPR GACTTGTAAACACAATCTTT AGG Intergenic
No off target data available for this crispr