ID: 1093780146

View in Genome Browser
Species Human (GRCh38)
Location 12:23126111-23126133
Sequence TTAACTTTGACAGTAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093780143_1093780146 23 Left 1093780143 12:23126065-23126087 CCTCCTGTTGACTCTGTAGACTT No data
Right 1093780146 12:23126111-23126133 TTAACTTTGACAGTAGAGAAAGG No data
1093780144_1093780146 20 Left 1093780144 12:23126068-23126090 CCTGTTGACTCTGTAGACTTGTA No data
Right 1093780146 12:23126111-23126133 TTAACTTTGACAGTAGAGAAAGG No data
1093780142_1093780146 30 Left 1093780142 12:23126058-23126080 CCACATTCCTCCTGTTGACTCTG No data
Right 1093780146 12:23126111-23126133 TTAACTTTGACAGTAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093780146 Original CRISPR TTAACTTTGACAGTAGAGAA AGG Intergenic
No off target data available for this crispr