ID: 1093783544

View in Genome Browser
Species Human (GRCh38)
Location 12:23166164-23166186
Sequence ATTTATTTACACAAGATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093783543_1093783544 -2 Left 1093783543 12:23166143-23166165 CCAAAGGAGTTTTGAATTTGCAT No data
Right 1093783544 12:23166164-23166186 ATTTATTTACACAAGATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093783544 Original CRISPR ATTTATTTACACAAGATGTC TGG Intergenic
No off target data available for this crispr