ID: 1093786142

View in Genome Browser
Species Human (GRCh38)
Location 12:23193956-23193978
Sequence ATCCATTGGAACTCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093786134_1093786142 17 Left 1093786134 12:23193916-23193938 CCTTCCCTCTTTTTTGGTTCTGC No data
Right 1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG No data
1093786132_1093786142 28 Left 1093786132 12:23193905-23193927 CCTTGGAAAGACCTTCCCTCTTT No data
Right 1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG No data
1093786131_1093786142 29 Left 1093786131 12:23193904-23193926 CCCTTGGAAAGACCTTCCCTCTT No data
Right 1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG No data
1093786136_1093786142 12 Left 1093786136 12:23193921-23193943 CCTCTTTTTTGGTTCTGCCTGTT No data
Right 1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG No data
1093786137_1093786142 -5 Left 1093786137 12:23193938-23193960 CCTGTTAAATCCCTATTCATCCA No data
Right 1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG No data
1093786135_1093786142 13 Left 1093786135 12:23193920-23193942 CCCTCTTTTTTGGTTCTGCCTGT No data
Right 1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG No data
1093786130_1093786142 30 Left 1093786130 12:23193903-23193925 CCCCTTGGAAAGACCTTCCCTCT No data
Right 1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093786142 Original CRISPR ATCCATTGGAACTCTGGCCA AGG Intergenic
No off target data available for this crispr