ID: 1093788443

View in Genome Browser
Species Human (GRCh38)
Location 12:23218873-23218895
Sequence GCTTCTTGTCGTCACCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093788443_1093788446 22 Left 1093788443 12:23218873-23218895 CCAGCTTGGTGACGACAAGAAGC No data
Right 1093788446 12:23218918-23218940 CTGCTAGACTGCAACTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093788443 Original CRISPR GCTTCTTGTCGTCACCAAGC TGG (reversed) Intergenic
No off target data available for this crispr