ID: 1093794741

View in Genome Browser
Species Human (GRCh38)
Location 12:23297972-23297994
Sequence GAGAACTCTCTTAAATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093794737_1093794741 20 Left 1093794737 12:23297929-23297951 CCTCAGATACATATGCTAATCAG No data
Right 1093794741 12:23297972-23297994 GAGAACTCTCTTAAATCTCCAGG No data
1093794736_1093794741 21 Left 1093794736 12:23297928-23297950 CCCTCAGATACATATGCTAATCA No data
Right 1093794741 12:23297972-23297994 GAGAACTCTCTTAAATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093794741 Original CRISPR GAGAACTCTCTTAAATCTCC AGG Intergenic
No off target data available for this crispr