ID: 1093797551

View in Genome Browser
Species Human (GRCh38)
Location 12:23331111-23331133
Sequence CTATAGGAAGGCTGTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093797551_1093797557 27 Left 1093797551 12:23331111-23331133 CCCATTTCACAGCCTTCCTATAG No data
Right 1093797557 12:23331161-23331183 CAAGCATTGCTGAGGAGAGCAGG No data
1093797551_1093797556 19 Left 1093797551 12:23331111-23331133 CCCATTTCACAGCCTTCCTATAG No data
Right 1093797556 12:23331153-23331175 ATACTAATCAAGCATTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093797551 Original CRISPR CTATAGGAAGGCTGTGAAAT GGG (reversed) Intergenic
No off target data available for this crispr