ID: 1093799032

View in Genome Browser
Species Human (GRCh38)
Location 12:23349449-23349471
Sequence ATTTAAGGAGGTTAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093799026_1093799032 -5 Left 1093799026 12:23349431-23349453 CCCACATCGATCTTGATGATTTA No data
Right 1093799032 12:23349449-23349471 ATTTAAGGAGGTTAGGAGGTTGG No data
1093799027_1093799032 -6 Left 1093799027 12:23349432-23349454 CCACATCGATCTTGATGATTTAA No data
Right 1093799032 12:23349449-23349471 ATTTAAGGAGGTTAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093799032 Original CRISPR ATTTAAGGAGGTTAGGAGGT TGG Intergenic
No off target data available for this crispr