ID: 1093800177

View in Genome Browser
Species Human (GRCh38)
Location 12:23363226-23363248
Sequence TAGGATACAGGGCCTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093800172_1093800177 16 Left 1093800172 12:23363187-23363209 CCTCAGAGATACTGGATGAGAGT No data
Right 1093800177 12:23363226-23363248 TAGGATACAGGGCCTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093800177 Original CRISPR TAGGATACAGGGCCTGAGCA GGG Intergenic
No off target data available for this crispr