ID: 1093801852

View in Genome Browser
Species Human (GRCh38)
Location 12:23383061-23383083
Sequence CACTCACACCCGAAGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093801852_1093801856 11 Left 1093801852 12:23383061-23383083 CCCTAGAGCTTCGGGTGTGAGTG No data
Right 1093801856 12:23383095-23383117 AAAACTTGATTTCAGACTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093801852 Original CRISPR CACTCACACCCGAAGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr