ID: 1093803838

View in Genome Browser
Species Human (GRCh38)
Location 12:23408211-23408233
Sequence ATCTATTTGTACTATCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093803837_1093803838 16 Left 1093803837 12:23408172-23408194 CCTGATGAGAGAGAGAAGGCTTT No data
Right 1093803838 12:23408211-23408233 ATCTATTTGTACTATCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093803838 Original CRISPR ATCTATTTGTACTATCATAT TGG Intergenic