ID: 1093804392

View in Genome Browser
Species Human (GRCh38)
Location 12:23414329-23414351
Sequence CAAATGTTCAACTGTTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093804392_1093804394 -3 Left 1093804392 12:23414329-23414351 CCTGCTAAACAGTTGAACATTTG No data
Right 1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG No data
1093804392_1093804396 13 Left 1093804392 12:23414329-23414351 CCTGCTAAACAGTTGAACATTTG No data
Right 1093804396 12:23414365-23414387 AAACCGGGAAAGAGAACAGCAGG No data
1093804392_1093804395 -2 Left 1093804392 12:23414329-23414351 CCTGCTAAACAGTTGAACATTTG No data
Right 1093804395 12:23414350-23414372 TGAACTAAATAGGAAAAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093804392 Original CRISPR CAAATGTTCAACTGTTTAGC AGG (reversed) Intergenic
No off target data available for this crispr