ID: 1093806914

View in Genome Browser
Species Human (GRCh38)
Location 12:23445715-23445737
Sequence ACATTGGCAGGCACTATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093806910_1093806914 30 Left 1093806910 12:23445662-23445684 CCTGGACAGTGAGGGAGTGAAGT No data
Right 1093806914 12:23445715-23445737 ACATTGGCAGGCACTATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093806914 Original CRISPR ACATTGGCAGGCACTATCAA GGG Intergenic
No off target data available for this crispr