ID: 1093807017

View in Genome Browser
Species Human (GRCh38)
Location 12:23446794-23446816
Sequence AAGCTTTTGGCTATACTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093807017_1093807021 25 Left 1093807017 12:23446794-23446816 CCTTTGAGTATAGCCAAAAGCTT No data
Right 1093807021 12:23446842-23446864 ACTGAGTATCTGTTTGCCAACGG No data
1093807017_1093807019 2 Left 1093807017 12:23446794-23446816 CCTTTGAGTATAGCCAAAAGCTT No data
Right 1093807019 12:23446819-23446841 TTCCTCACACAGAATACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093807017 Original CRISPR AAGCTTTTGGCTATACTCAA AGG (reversed) Intergenic
No off target data available for this crispr