ID: 1093807018

View in Genome Browser
Species Human (GRCh38)
Location 12:23446807-23446829
Sequence TGTGTGAGGAAAAAAGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093807018_1093807024 25 Left 1093807018 12:23446807-23446829 CCAAAAGCTTTTTTCCTCACACA No data
Right 1093807024 12:23446855-23446877 TTGCCAACGGACCACTGGATGGG No data
1093807018_1093807023 24 Left 1093807018 12:23446807-23446829 CCAAAAGCTTTTTTCCTCACACA No data
Right 1093807023 12:23446854-23446876 TTTGCCAACGGACCACTGGATGG No data
1093807018_1093807022 20 Left 1093807018 12:23446807-23446829 CCAAAAGCTTTTTTCCTCACACA No data
Right 1093807022 12:23446850-23446872 TCTGTTTGCCAACGGACCACTGG No data
1093807018_1093807021 12 Left 1093807018 12:23446807-23446829 CCAAAAGCTTTTTTCCTCACACA No data
Right 1093807021 12:23446842-23446864 ACTGAGTATCTGTTTGCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093807018 Original CRISPR TGTGTGAGGAAAAAAGCTTT TGG (reversed) Intergenic
No off target data available for this crispr