ID: 1093807023

View in Genome Browser
Species Human (GRCh38)
Location 12:23446854-23446876
Sequence TTTGCCAACGGACCACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093807018_1093807023 24 Left 1093807018 12:23446807-23446829 CCAAAAGCTTTTTTCCTCACACA No data
Right 1093807023 12:23446854-23446876 TTTGCCAACGGACCACTGGATGG No data
1093807020_1093807023 10 Left 1093807020 12:23446821-23446843 CCTCACACAGAATACATAAGGAC No data
Right 1093807023 12:23446854-23446876 TTTGCCAACGGACCACTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093807023 Original CRISPR TTTGCCAACGGACCACTGGA TGG Intergenic
No off target data available for this crispr