ID: 1093817010

View in Genome Browser
Species Human (GRCh38)
Location 12:23561240-23561262
Sequence CTCACTCCTGCAACCCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093817010 Original CRISPR CTCACTCCTGCAACCCAAGT AGG Intronic
900868349 1:5284393-5284415 CTCACTCCTGTCACCCAGGATGG - Intergenic
901488873 1:9585754-9585776 GTCACTCCTGTCACCCAAGCTGG - Intergenic
901584725 1:10279724-10279746 CTCACTCTTGTCACCCAAGCTGG + Intronic
901598386 1:10402932-10402954 CGCACTCCTGCATTCCAAGCTGG + Intronic
902510100 1:16961856-16961878 CTCACGCCTGTAATCCCAGTGGG - Intronic
903990383 1:27263691-27263713 CTCACGCCTGTAATCCCAGTGGG - Intronic
904757711 1:32777769-32777791 CTCACTCTTGTCACCCAAGCTGG - Intronic
906165590 1:43683770-43683792 CACACTCCTGCAGCACAAGTGGG - Exonic
907058282 1:51393105-51393127 CTCACTCTTGCTACTCATGTTGG + Intronic
907206976 1:52781467-52781489 TTCACTCCTGTCACCCAGGTTGG - Intronic
907235626 1:53044086-53044108 CTCACTCTTGTCACCCAGGTTGG + Intronic
907606876 1:55827096-55827118 CTCACTCCTGTAACCCAGGCTGG + Intergenic
907667434 1:56445922-56445944 CTCACTCTTGTTACCCAAGCTGG + Intergenic
908871373 1:68616689-68616711 CTCATTCCTGCAACTGGAGTGGG + Intergenic
909594440 1:77389916-77389938 CTCACCACTGCACTCCAAGTTGG + Intronic
910583651 1:88855682-88855704 CTCACTCCATCAACCCAGGCTGG + Intronic
910952624 1:92667025-92667047 CTCACACCTGCAATCCACTTTGG + Intronic
912321678 1:108719713-108719735 CTCACTCCAGCAGCTCAATTTGG - Intronic
913038947 1:115004571-115004593 CTCACTCCTGTCACCCAGGCTGG + Intergenic
914804997 1:150985139-150985161 CTCACTCCTGTCACCCAGGCTGG - Intronic
915294462 1:154910304-154910326 CTGACTCCTGCAAGCCAAGCAGG - Intergenic
919342294 1:196327694-196327716 CTCACTCCTGCCGCCCAGGCTGG + Intronic
919694883 1:200564228-200564250 CTCACTCTTGTCACCCAGGTTGG - Intronic
919869480 1:201809611-201809633 CTCACTCTTGCCACCCAGGCTGG + Intronic
920238088 1:204522890-204522912 TTCACTCTTGTAACCCAGGTTGG + Intronic
920558175 1:206919564-206919586 CTCACTCCTGTCACCCAGGCTGG - Intronic
920921756 1:210303348-210303370 CTCACTCCTGTCACCCAGGCTGG + Intergenic
922447061 1:225706537-225706559 CTCACTCCTGTCACCCAGGCCGG - Intergenic
922531898 1:226351198-226351220 CTCACTCCTGTAATCCCAGCAGG - Intergenic
922724489 1:227916042-227916064 CTCACCCCCGCAAGCCAAGATGG + Intergenic
922999291 1:229993199-229993221 CCCACTCCAGCCCCCCAAGTAGG + Intergenic
923131129 1:231075706-231075728 CTCACTCATGTAACTCAGGTTGG + Intergenic
924290357 1:242529896-242529918 TTCACTCCTGTTACCCAGGTTGG + Intergenic
1064182665 10:13132544-13132566 CTCACTCCTGTCACCCAGGCTGG + Intronic
1065032770 10:21604557-21604579 CTCACTCTTGCCACCCAGGCTGG - Intronic
1065816303 10:29486084-29486106 CTCCCTTCTGCAACCCAAAGAGG - Exonic
1065956555 10:30698494-30698516 CTCTCTTCTGCAACCCAAAGAGG + Intergenic
1067320579 10:45217056-45217078 CTCACTCTTGTCACCCAGGTTGG + Intergenic
1067850779 10:49752368-49752390 CTCACTTCTGCTCCCCAGGTTGG - Intronic
1068166001 10:53333478-53333500 GCCACTCCTGAAGCCCAAGTGGG - Intergenic
1068312125 10:55292409-55292431 CTCACTCTTGCTACCCAGGCTGG + Intronic
1068858986 10:61827527-61827549 CTCACTCTTGTAACCCAGGCTGG - Intergenic
1069238593 10:66109565-66109587 CTTACTCCTGCTACCTATGTTGG - Intronic
1070093757 10:73315588-73315610 CTCACTCTTGTCACCCAAGCTGG + Intronic
1071493928 10:86154912-86154934 CTCACCCCAGCAACCCCAGGAGG + Intronic
1071683621 10:87732491-87732513 CTCACTCCTATAGCCCAGGTTGG - Intronic
1072342506 10:94467769-94467791 CTCACTGCTGCACCCCAACCTGG - Intronic
1073175236 10:101552216-101552238 TTCACTCCTGTCACCCAAGCTGG + Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1075182544 10:120224948-120224970 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
1075415644 10:122260955-122260977 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1076877222 10:133221852-133221874 CTCACGCCTGTAACCCTAGGTGG + Intronic
1076877244 10:133221936-133221958 CTCACGCCTGTAACCCTAGGTGG + Intronic
1076877256 10:133221978-133222000 CTCACGCCTGTAACCCTAGGTGG + Intronic
1077536111 11:3125057-3125079 CTCCCTCCTGCAGGCCAGGTGGG + Intronic
1078504638 11:11925365-11925387 CTCACGCCTGTAATCCCAGTGGG - Intronic
1079108376 11:17588903-17588925 CTCAATCCTGCAACCCCACAGGG + Intronic
1079113217 11:17619239-17619261 CTCACTCCTGTCACCCAGGCTGG - Intronic
1081403043 11:42664854-42664876 CTCACTCCTGCAACAAAAGGTGG - Intergenic
1083912099 11:65715992-65716014 CTCACTCCTGTCACCCAGGCTGG - Intronic
1084307577 11:68297085-68297107 ATAACTTCTGCCACCCAAGTTGG - Intergenic
1084867453 11:72070693-72070715 CTCACTGCAGCCTCCCAAGTGGG - Intronic
1085730071 11:78990032-78990054 CTCACTCCTGTCACCCAGGCTGG - Intronic
1085786582 11:79456901-79456923 TTCACCCCTCCCACCCAAGTTGG - Intergenic
1086328159 11:85725661-85725683 CTCTCCCTTGCAAGCCAAGTTGG - Intronic
1086812399 11:91326716-91326738 CTAATTCCTCCAACCCAAGATGG + Intergenic
1087396941 11:97611141-97611163 ATGACTCCTGAAGCCCAAGTGGG + Intergenic
1088657429 11:112014029-112014051 CTCACTCCTCCTCCCCAAGGAGG + Intronic
1088662374 11:112060482-112060504 CTCACTCTTGTCACCCAGGTTGG + Intronic
1088736185 11:112729510-112729532 CTCACTCCTGTAATCCCAGGAGG + Intergenic
1090598890 11:128349010-128349032 CTCACTCTTGCTACCCACGCTGG - Intergenic
1093098736 12:15001982-15002004 CGCACTGCTGTAACCCGAGTGGG - Intergenic
1093486360 12:19657137-19657159 CTCATTCCTCCTTCCCAAGTTGG + Intronic
1093810960 12:23491589-23491611 CTCACTCCTGTCACCCAGGCTGG + Intergenic
1093817010 12:23561240-23561262 CTCACTCCTGCAACCCAAGTAGG + Intronic
1094311680 12:29090880-29090902 CTCACTCCTGTTGCCCAGGTTGG - Intergenic
1094354762 12:29565815-29565837 CTCACTCCTGTTGCCCAAGCTGG - Intronic
1094436101 12:30422409-30422431 TTCACTCCTGTCACCCAGGTTGG - Intergenic
1096482927 12:51954133-51954155 GTCACTCCTCCAGCCCACGTAGG - Intronic
1096699401 12:53372178-53372200 CAGACCCCTGCACCCCAAGTGGG - Intergenic
1097034585 12:56114924-56114946 CTCACTCCTGTCACCCAGGCTGG - Intergenic
1097643255 12:62206556-62206578 CTCACTCCTGTCACCCAGGCGGG + Intronic
1097811177 12:64020811-64020833 CTCACTCTTGTCACCCAAGCTGG - Intronic
1099077620 12:78130709-78130731 GTCCTCCCTGCAACCCAAGTTGG - Intronic
1099195362 12:79609037-79609059 CTCACTCCTGTCACCCAGGCTGG - Intronic
1099809742 12:87565798-87565820 CTCACTCTTGTCACCCAGGTTGG - Intergenic
1102288428 12:111678717-111678739 CTCACTCTTGCCACCCAGGCTGG + Intronic
1105227785 13:18452519-18452541 CTCACTCCTGTCACCCAGGCTGG - Intergenic
1106089851 13:26580959-26580981 CACACTCCTGTCACCCAAGCTGG + Intronic
1108846174 13:54680127-54680149 GTGACTCCTGGAGCCCAAGTGGG - Intergenic
1109102300 13:58200313-58200335 CTCATGCCTGCAACCCAAGAAGG - Intergenic
1109705932 13:66092732-66092754 CTCATTCCTGAAGCCCAAGAGGG - Intergenic
1112696330 13:101953002-101953024 CTCACTCTTGTCACCCAGGTTGG - Intronic
1114735022 14:25035119-25035141 CTCACTCTTGTCACCCAAGCTGG - Intronic
1115078225 14:29416897-29416919 TTCAGCCCTGCAACCCAAGGAGG - Intergenic
1115109820 14:29807984-29808006 CTCACTCCTGTAACTCTAGCAGG - Intronic
1116027427 14:39532025-39532047 CTCACACCTGCAATCCCAGCAGG - Intergenic
1117389861 14:55252325-55252347 CTCACTCCTGTCACCCAGGCTGG - Intergenic
1117462517 14:55959337-55959359 CTCACTCCTGTCACCCAGGTTGG + Intergenic
1117535733 14:56701205-56701227 CTCACTCTTGTCACCCAAGCTGG - Intronic
1118343889 14:64919770-64919792 CTCACTTCAGCCTCCCAAGTAGG - Intronic
1119368667 14:74118742-74118764 CTCACTCCTGTCACCCAGGCTGG - Intronic
1119614336 14:76089015-76089037 CTCACCCCCACATCCCAAGTAGG - Intergenic
1120865048 14:89288919-89288941 CTCACACCTGTAATCCCAGTTGG + Intronic
1121159701 14:91726265-91726287 GTGACTCCTGAAACCCAAGTGGG - Intronic
1121446130 14:93980374-93980396 CTCACACCTGGAACCAAGGTGGG + Intergenic
1122469062 14:101953827-101953849 CTCACTCTTGCCACCCAGGCTGG - Intergenic
1124485177 15:30108028-30108050 CTCACTCCTGTCACCCAGGGTGG + Intergenic
1124518401 15:30389244-30389266 CTCACTCCTGTCACCCAGGGTGG - Intronic
1124540252 15:30577004-30577026 CTCACTCCTGTCACCCAGGGTGG + Intergenic
1124758401 15:32430574-32430596 CTCACTCCTGTCACCCAGGGTGG - Intergenic
1124806757 15:32891496-32891518 CTCACGCCTGTAATCCCAGTTGG - Intronic
1126149738 15:45512965-45512987 CTCACTCTTGTCACCCAAGTTGG - Intronic
1126333872 15:47565186-47565208 GTGACTCCTGCAGCCCCAGTGGG - Intronic
1127395792 15:58543086-58543108 CTCCCTCCCTCAACCCAAATGGG - Intronic
1128468701 15:67934045-67934067 GTCACTTCTGCAAACCCAGTGGG - Intergenic
1129870890 15:78940505-78940527 CTCACTCCTGTCACCCAGGCAGG - Intronic
1130893728 15:88154299-88154321 CCCACTGCTTCAACCCAAGGAGG - Intronic
1131116602 15:89799880-89799902 ATCACACCTGTCACCCAAGTGGG + Intronic
1131511821 15:93053388-93053410 CTTTCTCCTGGAACCCATGTAGG - Intronic
1132102078 15:99031208-99031230 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1132376777 15:101333391-101333413 CTGTCTCCTGCGACCCAAGCTGG + Intronic
1133212003 16:4268619-4268641 CTCACTCCCGTCACCCAAGCTGG + Intronic
1133813364 16:9178089-9178111 CTCACGCCTGCAATCCCAGCAGG + Intergenic
1133933098 16:10248334-10248356 CCCACTCCAGCCTCCCAAGTAGG + Intergenic
1134438024 16:14279689-14279711 CTCACTCCTGTAATCCAAGCAGG + Intergenic
1135459298 16:22627665-22627687 CTCACACCTGCAATCCCAGGAGG + Intergenic
1135767364 16:25189248-25189270 CTCACTCCTGTCACCCATGTTGG + Intergenic
1136628358 16:31475454-31475476 CTCACTCTTGTGACCCAAGCTGG + Intronic
1137316941 16:47335326-47335348 CTCGCTCTTGCAACCCAGGCTGG - Intronic
1138565285 16:57828458-57828480 CTCCCTCCCGCCACCCACGTTGG - Intronic
1138982774 16:62290586-62290608 TTCACTCCTGCAAACAAAGTTGG + Intergenic
1139328011 16:66166902-66166924 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
1142463599 17:113599-113621 CTCATACCTGTAACCCAAGCAGG - Intergenic
1145087416 17:19954000-19954022 CTCACTTCTGTCACCCAGGTTGG - Intronic
1146384274 17:32355357-32355379 TTCACTCTTGTAGCCCAAGTTGG - Intronic
1146685918 17:34841638-34841660 CTCACTCCTGCCACCCCATGGGG + Intergenic
1147428534 17:40357489-40357511 CTCACCCCTGCACCCCCAGCTGG + Intronic
1148391819 17:47278321-47278343 CTCACTCCTGTAATCCCAGCAGG + Intronic
1148846021 17:50530463-50530485 CTCACTCTTGTCACCCAAGCTGG - Intronic
1148985743 17:51619474-51619496 CTCACCCCTCCCACCCAAGTTGG - Intergenic
1149829202 17:59856378-59856400 CTCACACCTGTAATCCAAGGAGG + Intergenic
1150242189 17:63643479-63643501 CTTACTCCTGCCACCCAAGCTGG - Intronic
1150408213 17:64920106-64920128 CTCACTCTTGCAGCCCAGGCTGG - Intergenic
1151628670 17:75294799-75294821 CTCACTCTTGCCACCCAGGCTGG - Intergenic
1151652683 17:75479886-75479908 CTCACTCCTGTTGCCCAAGTTGG - Intronic
1152270080 17:79319404-79319426 ACCACTCCGGCAGCCCAAGTGGG - Intronic
1153086678 18:1296504-1296526 CTAACTCCCGAAGCCCAAGTGGG + Intergenic
1153694699 18:7628121-7628143 CTCACTCTTGTCACCCAGGTTGG - Intronic
1153756949 18:8293986-8294008 CTCACTCCTGTAATCCCAGCAGG + Intronic
1155013503 18:21807400-21807422 CTCACTCCTGCCACCCAGGCTGG - Intronic
1155235745 18:23817020-23817042 CTCACTCCTGGGTCCCAAGAGGG - Intronic
1155962575 18:32007018-32007040 CTCACTCCTGCCCCCCAGGCTGG - Intergenic
1157250923 18:46095644-46095666 CTCACTCTTGTCACCCAGGTCGG + Intronic
1157645633 18:49266579-49266601 CTCACTCTTGCCACCCATGCTGG - Intronic
1157815003 18:50723832-50723854 CTCACTCCTGCCATCCAGGTTGG - Intronic
1158467711 18:57705889-57705911 CTCACTCCTGTCACCCAAGCTGG + Intronic
1158867610 18:61652951-61652973 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1160069689 18:75615953-75615975 TTCACTCTTGTAACCCAGGTTGG - Intergenic
1160886818 19:1354004-1354026 CTCACTCCTGTAATCCCAGCAGG - Intergenic
1160970727 19:1766656-1766678 GTCATTGCTGCAACCCAAGCTGG - Intronic
1161406304 19:4093186-4093208 CTCACTCTTGTCACCCAGGTTGG - Intronic
1161883728 19:6976715-6976737 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1163825707 19:19523568-19523590 CCCACTTCAGCCACCCAAGTAGG + Intronic
1164294877 19:23901122-23901144 CTCACTCTTGTCACCCAGGTTGG + Intergenic
1165643348 19:37409267-37409289 CTCACTCCTGTCACCCAGGCTGG - Intergenic
1165703444 19:37956513-37956535 CTCACTCTTGTCACCCAGGTTGG + Intronic
1166084924 19:40468105-40468127 TTCACTCTTGTCACCCAAGTTGG + Intronic
1166953202 19:46444265-46444287 CTCACTCCTGTCACCCAGGCTGG + Intergenic
1166999389 19:46736973-46736995 CTCACCCCTCCAACCCAAATCGG + Intronic
1167209915 19:48127723-48127745 CTCATCCCAGCATCCCAAGTAGG - Intronic
1168024040 19:53630874-53630896 CTCACTCCTGTCACCCAGGCTGG + Intergenic
1168112057 19:54198393-54198415 CTCACACCTGTAACCCCAGGTGG - Intergenic
1168211389 19:54893301-54893323 CTCGCTCTTGTCACCCAAGTTGG + Intergenic
1168283488 19:55319139-55319161 CTCACTCTTGCAGCCCAGGCTGG + Intronic
1168447053 19:56428011-56428033 TTCACTCTTGTTACCCAAGTCGG - Intronic
925869792 2:8259917-8259939 TTCAGTTCTGCAACCCAAGTTGG - Intergenic
925885271 2:8390196-8390218 CTCTCTCCTGAAGCCCAGGTAGG + Intergenic
927949509 2:27157939-27157961 CTCACTCCTGTTGCCCAAGCTGG - Intergenic
928322224 2:30292877-30292899 CTCACTCCTGTCACCCAGGCTGG - Intronic
928630825 2:33189995-33190017 CTCACTCCTGTCACCCAGGCTGG - Intronic
929963487 2:46514247-46514269 CTCACTCTTGTCACCCAAGCTGG - Intronic
930956962 2:57214465-57214487 TTCATTCCTGCAACCCATTTAGG + Intergenic
931725959 2:65110890-65110912 CTCACTACTGCATTCCAACTTGG + Intronic
932191291 2:69743041-69743063 CTCACTCCTGTAGCCCAGGCTGG + Intronic
936403597 2:112184054-112184076 CTCAGGCCTGAAGCCCAAGTGGG + Intronic
937158870 2:119741496-119741518 CTCACTCCTGTCACCCAGGCTGG + Intergenic
938033842 2:128019067-128019089 CTCACTCTTGTTACCCAGGTAGG - Intronic
940142557 2:150509315-150509337 CCCACTTCAGCATCCCAAGTAGG + Intronic
941566029 2:167109308-167109330 CTCACTCTTGTCACCCAAGCTGG + Intronic
941904884 2:170711172-170711194 CTAACGCCTGCATCTCAAGTCGG - Intergenic
943451347 2:188045692-188045714 CTCACTCTTGTAGCCCAAGCTGG - Intergenic
944760170 2:202806614-202806636 CTCACTCCTGTCAGCCACGTCGG - Intronic
944831522 2:203537759-203537781 CTCACTCTTGTCACCCAGGTTGG - Intergenic
946038801 2:216766211-216766233 CTCACTCCTGCCACCCGCCTTGG - Intergenic
946219598 2:218215581-218215603 CTCACTCTTGTCACCCAAGCTGG - Intergenic
946442200 2:219706313-219706335 CTCACTCCTGTCACCCAGGCTGG + Intergenic
946803484 2:223446441-223446463 CTCACTCCTGTCACCCAGGCTGG + Intergenic
946853941 2:223934548-223934570 CTCACTCTTGTCACCCAAGCTGG + Intronic
946945944 2:224822681-224822703 CTCACTCTGTCAACCCAAGCTGG - Intronic
947129211 2:226904234-226904256 GCGACTCCTGAAACCCAAGTGGG - Intronic
947618427 2:231573679-231573701 CTCACTCCTGCAGAACAACTGGG + Intergenic
948129034 2:235586650-235586672 CTCACTCTGACAACCCAAGTTGG - Intronic
948973152 2:241444957-241444979 CTCACTCCTGTCACCCAGGCTGG + Intronic
1169020121 20:2324667-2324689 CACTCTCCAGCAACCCAGGTTGG + Intronic
1169456454 20:5756719-5756741 CTCACTCTTGTAGCCCAAGCTGG + Intronic
1172578307 20:36026597-36026619 CTCACTCCAGCAGCCCAGGCGGG + Intronic
1172929743 20:38577523-38577545 CTCCCTCCTGCAACTTAAGAAGG - Exonic
1173081516 20:39872693-39872715 CTCACTCCTGTAATCCCACTTGG - Intergenic
1174381001 20:50155361-50155383 CTCACTCTTGTCACCCAGGTTGG - Intergenic
1175238955 20:57532674-57532696 CTCACACCTGCAATCCAAGGAGG - Intergenic
1175260980 20:57673924-57673946 CTCACTCATGCAACCAACATGGG + Intronic
1176068499 20:63213400-63213422 CTCACTCTTGCCACCCAGGCTGG - Intronic
1176385479 21:6136892-6136914 CTCCCTCCTCCAACCCAAACAGG + Intergenic
1177784989 21:25662175-25662197 CTCACTCCTGTCACCCCAGCTGG + Intronic
1179737994 21:43401360-43401382 CTCCCTCCTCCAACCCAAACAGG - Intergenic
1179895286 21:44358381-44358403 CTCCTTCCTGCCACCCAAGGGGG - Intronic
1180722401 22:17919318-17919340 CTCACACCTGTAATCCCAGTGGG - Intronic
1181939940 22:26467930-26467952 CTCACTCTTGCTACCCAGGCTGG + Intronic
1181987275 22:26808903-26808925 CTCAGCCCTGCACCCCAAGGTGG - Intergenic
1182077216 22:27503187-27503209 CTCACTCTTGTTACCCAGGTTGG + Intergenic
1182104681 22:27680997-27681019 CTCACTCCTGCAGAGCAAGGGGG + Intergenic
1182329575 22:29541474-29541496 CTCACTCCTGTCACCCAGGCTGG - Intronic
1182375636 22:29845596-29845618 CTCACACCTGCAATACTAGTTGG - Intergenic
1183496866 22:38151274-38151296 CTCACTCCTGTCACCCACGCTGG + Intronic
1183820426 22:40341575-40341597 CTCACTCCTGGAAAAGAAGTAGG - Intergenic
1184144575 22:42601867-42601889 CTCAGTCCATCCACCCAAGTAGG + Intronic
949850969 3:8419925-8419947 CTCTCTCCCGCAAGCCACGTGGG + Intergenic
950207169 3:11089782-11089804 CTCACTCCTGTTACCCAGGCTGG - Intergenic
950853446 3:16084218-16084240 CTCACTCTTGCCACCTAAGCTGG + Intergenic
951543181 3:23802418-23802440 CTCACTCCCACCACCCAGGTTGG + Intergenic
951889556 3:27555743-27555765 TTCACTCCTGCCACCCAGGCTGG + Intergenic
952407721 3:33019572-33019594 CTCATTCCTGCAACACAGGAAGG - Intronic
952587973 3:34916079-34916101 CTCACTCTTGTCACCCAGGTTGG + Intergenic
953337788 3:42108459-42108481 CTCACTCCTGTCACCCACGCTGG - Intronic
954072740 3:48154903-48154925 CTCACTCCTGTCACCCAGGCTGG + Intergenic
954825898 3:53373231-53373253 CTCACTCCTGAAGCCCAGGCTGG + Intergenic
954890293 3:53921258-53921280 CTCACTCCTGTCACCCAGGCGGG - Intergenic
955170520 3:56560260-56560282 CTCACTCTTGTCACCCAGGTTGG + Intronic
955748986 3:62168713-62168735 GTGACTCCTGAAGCCCAAGTGGG + Intronic
955835746 3:63053227-63053249 CCCACTCCTGCAACACCAGGAGG - Intergenic
956071712 3:65459893-65459915 CTCACTCCTGTTGCCCATGTTGG - Intronic
956672036 3:71700143-71700165 CTCACTCCTGTTGCCCAAGTTGG - Intronic
957549959 3:81691502-81691524 CTCACACCTGTAGCCCAAGAAGG + Intronic
958436602 3:94104420-94104442 CTCACTCCTGAACCCCAACCAGG + Intronic
958964298 3:100541557-100541579 CTCACTCCTGTCACCCAGGCTGG + Intronic
959942019 3:112090322-112090344 CTCACTCCTGCCACCCAGGCTGG + Intronic
960067796 3:113393553-113393575 CTCACTCTTGACACCCAAGCTGG + Intronic
961167219 3:124771716-124771738 CTCACTCCCGCCACCCAGGCTGG - Intronic
961685782 3:128629529-128629551 CTCACTCTTGCCACCCAGGCTGG - Intronic
961761705 3:129174627-129174649 TTCACTCTTGTAACCCACGTTGG - Intronic
961863397 3:129936148-129936170 TTCACTCTTGCAACCCAGGCTGG + Intergenic
964104746 3:153027154-153027176 CTCACACCTGTAATCCCAGTGGG + Intergenic
964142365 3:153418849-153418871 CTCACTCTTGTCACCCAAGCTGG + Intergenic
964247142 3:154666786-154666808 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
964447683 3:156777369-156777391 CACACTCCTTCAACCCAACCAGG - Intergenic
964875083 3:161358125-161358147 CTCACTTCAGCTTCCCAAGTAGG + Intronic
966207168 3:177416930-177416952 TTCACTCCTGTTGCCCAAGTTGG + Intergenic
966286086 3:178296820-178296842 CTCACTCTTGTCACCCAAGCTGG - Intergenic
966687271 3:182709621-182709643 CTCCCTCCTTCATCCCCAGTGGG + Intergenic
967021451 3:185526489-185526511 TTCACTCCTGCCACCCAGGCTGG - Intronic
968364123 3:198172664-198172686 CTCATACCTGTAACCCAAGCAGG + Intergenic
972489290 4:39571830-39571852 CTCACTCCAGTCACCCAGGTTGG + Intronic
977441232 4:97070546-97070568 GTGACTCCTGAAGCCCAAGTGGG - Intergenic
978814903 4:112893263-112893285 CTCACCTCAGCATCCCAAGTAGG + Intronic
981094064 4:140760602-140760624 CTCTCTCCTCCAACCCTAATAGG + Intergenic
982279762 4:153671218-153671240 CTCACTTCAGCATCCCAAGTAGG + Intergenic
982781185 4:159492952-159492974 CTCACTCCTACAACTCCACTAGG - Intergenic
983618413 4:169733624-169733646 CTCACGCCTGTAATCCTAGTGGG + Intronic
984975903 4:185229856-185229878 CTCACTCCTGTCACCCAGGCTGG + Intronic
985865773 5:2512836-2512858 CTCGCTCCTCCAACACCAGTGGG + Intergenic
986144095 5:5060734-5060756 CTCACTCCTGTAATTCAGGTGGG - Intergenic
988528072 5:32003739-32003761 CTCACTCCTGTCACCCAGGCTGG + Intronic
989196688 5:38723396-38723418 CTCACACCTGCCAGCCATGTGGG - Intergenic
990280751 5:54248367-54248389 CACTCTCCTGCAACCATAGTTGG + Intronic
992215636 5:74522449-74522471 CTCACTCCTGTTGCCCAGGTTGG + Intergenic
992300639 5:75375549-75375571 CTCACTCCTGTCGCCCAGGTTGG - Intronic
992839476 5:80673497-80673519 CTCACTCCTGTCACCCAGGCTGG - Intronic
995747036 5:115414975-115414997 CTCACTAATGCAGCTCAAGTGGG - Intergenic
995832349 5:116367111-116367133 CTCACGCCTGTAATCCCAGTAGG - Intronic
997943159 5:138176831-138176853 CTCACACCTGTAATCCCAGTAGG + Intronic
997994952 5:138577857-138577879 CCCACTCCAGCCTCCCAAGTAGG - Intergenic
998402471 5:141854999-141855021 CTCACTCCTGTCACCCAGGCTGG + Intronic
998415737 5:141945032-141945054 CTGACTCCTGCTACCCAAGAAGG + Exonic
998991957 5:147827104-147827126 CTCACTCTTGTCACCCAGGTTGG + Intronic
999579619 5:153022478-153022500 CTCACGCCTGTAATCCCAGTGGG + Intergenic
1000339631 5:160267026-160267048 CTGCCTCTTGCAACCCAACTGGG - Intronic
1002319885 5:178368774-178368796 AGCACTGCTGCAAGCCAAGTAGG + Intronic
1002880781 6:1250643-1250665 CTAACTCCTGCACACCAACTAGG + Intergenic
1004151666 6:13125898-13125920 CTCACTCCTGCTGCCCAGGATGG - Intronic
1004384900 6:15164291-15164313 TTCACTCCTGCCACCCAGGCTGG + Intergenic
1005931411 6:30487557-30487579 CTCACGCCTGTAATCCCAGTCGG - Intergenic
1006311616 6:33265100-33265122 TTCACTCTTGCCACCCAAGCTGG + Intronic
1006740502 6:36304765-36304787 AGCAATCCTGCACCCCAAGTCGG + Intronic
1006860271 6:37167720-37167742 CTCACACCTGTAATCCAAGGAGG + Intergenic
1006914030 6:37583208-37583230 CTCACTCCTGCACCCAGACTGGG + Intergenic
1009468457 6:64002488-64002510 GTGACTCCCGAAACCCAAGTGGG - Intronic
1011077738 6:83455374-83455396 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1014867532 6:126550616-126550638 GTGACTCCTGAAGCCCAAGTAGG + Intergenic
1015171056 6:130254021-130254043 CTCACTCCTGTCACCCAGGCTGG + Intronic
1015474203 6:133641325-133641347 CACACTCCTGAAAGCCTAGTTGG + Intergenic
1016341253 6:143063728-143063750 ATGATTCCTGCAATCCAAGTTGG - Intronic
1016660666 6:146575488-146575510 CTCACTCCTGTTGCCTAAGTGGG + Intergenic
1016720467 6:147290176-147290198 CTCACTCCTGTAGCCCAGGATGG - Intronic
1017040154 6:150301768-150301790 CTTAAACCTGCAACACAAGTCGG + Intergenic
1017291612 6:152744568-152744590 CTCTCTCCTGCAGCCCTAGAGGG - Intergenic
1017774939 6:157673158-157673180 CTCACTCCTGCTGCCCATGGAGG - Exonic
1017835475 6:158173663-158173685 CTCAGCCCTGGAAGCCAAGTTGG + Intronic
1017864508 6:158431494-158431516 CTCACTGCTGTATCCCCAGTGGG - Intronic
1017989794 6:159476247-159476269 CTCACTCTTGTCACCCAGGTTGG - Intergenic
1019110244 6:169703484-169703506 CTCATGCCTGTACCCCAAGTAGG + Exonic
1019965163 7:4492688-4492710 CTCACTCCTGTCACCCAGGCAGG - Intergenic
1024791815 7:52973597-52973619 CTCACTCCTGATGCCAAAGTAGG + Intergenic
1025219837 7:57097648-57097670 CTCACTCTTGTCACCCAGGTTGG - Intergenic
1025630618 7:63269193-63269215 CTCACTCTTGTCACCCAGGTTGG - Intergenic
1025651852 7:63477415-63477437 CTCACTCTTGTCACCCAGGTTGG + Intergenic
1025817738 7:64932999-64933021 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1026515878 7:71071424-71071446 CTCACTCCAGCCTCCCAAGCTGG + Intergenic
1026831073 7:73610493-73610515 CTCACTCTTGTCACCCAAGTTGG + Intronic
1027186770 7:75976878-75976900 CTCACTCCTGTCACCCAGGCTGG + Intronic
1027684782 7:81266877-81266899 CTGATTCCTGCAACTCAATTGGG + Intergenic
1027888353 7:83938013-83938035 GACACTCCTGAAGCCCAAGTAGG - Intergenic
1029031025 7:97467111-97467133 CTCCCTCCTTCAAGCCAAGTGGG - Intergenic
1029863202 7:103597570-103597592 CTCACTCTTGTCACCCAAGCTGG - Intronic
1030804268 7:113895024-113895046 CTCACACCTGCCACCCTATTGGG - Intronic
1032082104 7:128864628-128864650 CTCACTCCTGTCACCCAGGCTGG + Intronic
1032159590 7:129500532-129500554 CTCACGCCTGTAATCCCAGTGGG + Intergenic
1032434956 7:131893091-131893113 CTCACTCCTGTAGCCCAGGGTGG + Intergenic
1032795669 7:135274287-135274309 CTCACTTTTGCCACCCAGGTGGG - Intergenic
1032868382 7:135952927-135952949 CTCACTCCTGTCACCCAGGCTGG - Intronic
1033785538 7:144726190-144726212 ATCACTGCTGCAATCCTAGTGGG - Intronic
1033881263 7:145886906-145886928 GTGACTCCTGAAGCCCAAGTAGG + Intergenic
1034239995 7:149602956-149602978 CTCACTTCAGCTTCCCAAGTAGG - Intergenic
1035220481 7:157403494-157403516 CTCATTCCTGCTGCCCAAGCTGG + Intronic
1036389840 8:8316011-8316033 CTCACTCTTGTTACCCAAGCTGG + Intergenic
1036916330 8:12807324-12807346 CTCACTCCTGTCACCCAGGCTGG - Intergenic
1037080920 8:14784870-14784892 TTCACTCTTGTTACCCAAGTTGG - Intronic
1037116087 8:15229569-15229591 CTCTCTCATGCATCCCATGTTGG + Intronic
1037315144 8:17593566-17593588 CTCACTCCTGTTGCCCAGGTTGG - Intronic
1038769020 8:30458991-30459013 CTCACTCTTGTCACCCAAGCTGG + Intronic
1041373015 8:57183799-57183821 CTCACTCCTGTTGCCCAGGTGGG - Intergenic
1042357803 8:67848259-67848281 CTAACTCATGCAAACCAACTGGG - Intergenic
1043351281 8:79363624-79363646 CTCACTCCTGTCACCCAGGCTGG + Intergenic
1045188219 8:99858958-99858980 CAAACACCTGCAACCCAAGAAGG + Intronic
1046474050 8:114717391-114717413 CTCACTCCAGCAACACATTTTGG - Intergenic
1046944885 8:119965250-119965272 CACACTCCTGCAGCCCAGGGAGG + Exonic
1048531458 8:135253884-135253906 GTGACTCCTGAAGCCCAAGTAGG - Intergenic
1048646480 8:136426794-136426816 CCCACCCTTGCAACCCAAGATGG - Intergenic
1048731079 8:137441765-137441787 GTGACTCCTGAAGCCCAAGTGGG + Intergenic
1048752649 8:137697501-137697523 CTCACTCCTGGAACTCTACTAGG - Intergenic
1049281197 8:141746104-141746126 CTCACTCCCATAACCCCAGTGGG - Intergenic
1049507853 8:143013409-143013431 CTCAACCCTGAAACCGAAGTTGG - Intergenic
1050297928 9:4225474-4225496 CTCATTCCTGCAACCTAACGAGG + Intronic
1050440233 9:5654274-5654296 CTCACTCTTGCTACCCAGGCTGG + Intronic
1050806386 9:9683910-9683932 ATGACTCCAGCAACCCAAGCTGG + Intronic
1051257549 9:15230715-15230737 CTCACTCCTGTAATCCCAGCAGG + Intronic
1052113432 9:24618886-24618908 TTGACTCCTGCAGCCCCAGTGGG + Intergenic
1052130706 9:24843357-24843379 CTCACTCTTGTCACCCAGGTTGG + Intergenic
1052766517 9:32646776-32646798 CTCACTCTTGTCACCCAGGTTGG - Intergenic
1055365076 9:75534883-75534905 CTCACTCCTGTCACCCAGGCTGG - Intergenic
1055377852 9:75669722-75669744 TTCACACCTGCCACCCAAGCAGG + Intergenic
1055436370 9:76296108-76296130 CTCACTCTTGTCACCCAGGTTGG + Intronic
1056684329 9:88747056-88747078 CTCACTCGTGCACACAAAGTGGG + Intergenic
1057467433 9:95328319-95328341 CTCACGCCTGTAATCCCAGTTGG + Intergenic
1059152836 9:111964798-111964820 TTCACTCTTGCTGCCCAAGTTGG - Intergenic
1061482610 9:130904370-130904392 CTCACACATGCAACACCAGTGGG - Intronic
1061702464 9:132426396-132426418 TTTCCACCTGCAACCCAAGTTGG + Intronic
1185800352 X:3005077-3005099 CTCACTCTTGCTACCCAGGCTGG + Intergenic
1186979585 X:14944913-14944935 CTCACTCTTGTCACCCAGGTTGG + Intergenic
1187175582 X:16893666-16893688 CTCACTCTTGTCACCCAAGCAGG + Intergenic
1187323391 X:18262740-18262762 TTCACTCCTGTCACCCAAGCTGG + Intronic
1187380555 X:18798109-18798131 CTCACTCCTGTAGTCCAGGTGGG + Intronic
1187716408 X:22106742-22106764 CTCACTCCTGTCACCCAGGCTGG - Intronic
1187910233 X:24104729-24104751 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1187952438 X:24484271-24484293 CTCACACCTGTAATCCCAGTGGG - Intronic
1189888422 X:45574166-45574188 CTCACTCTTGTCACCCAAGCTGG + Intergenic
1190202653 X:48376796-48376818 CTCACTCGTGTCACCCAAGCTGG - Intergenic
1190207885 X:48418614-48418636 CTCACTCGTGTCACCCAAGCTGG + Intergenic
1190825825 X:54017183-54017205 CTCACGCCTGTAATCCCAGTTGG + Intronic
1192159316 X:68771118-68771140 ATCACTTCTGCAACCCAGGCAGG - Intergenic
1192457104 X:71285200-71285222 TTAACACCTGGAACCCAAGTAGG + Intronic
1192492659 X:71589839-71589861 CTCACTCCTGTCACCCAGGTGGG + Intronic
1195466056 X:105180305-105180327 TTCACTCTTGCAGCCCAAGCTGG - Intronic
1195499054 X:105573086-105573108 CTCACTCCTGTCACCCAGGCTGG + Intronic
1196020084 X:110982251-110982273 TCCACTCCTGCACACCAAGTTGG + Intronic
1196842025 X:119867981-119868003 CTCACTCCTGTCACCCAGGTTGG + Intergenic
1197421789 X:126244884-126244906 CTCACTCCTGTCACCCAGGCTGG - Intergenic
1201319066 Y:12677455-12677477 TTCACTCTTGTAACCCAGGTTGG + Intergenic