ID: 1093821169

View in Genome Browser
Species Human (GRCh38)
Location 12:23619580-23619602
Sequence ACAAAGAGACAAACCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093821169 Original CRISPR ACAAAGAGACAAACCTGGGA AGG Intronic
900077675 1:831037-831059 ATAAAGAGCCAACCCAGGGAGGG - Intergenic
900565853 1:3331522-3331544 ACAAAGGGACACACATGGGACGG + Intronic
900883939 1:5402242-5402264 ACAAATGGGCAAACCTGAGAGGG - Intergenic
902598738 1:17526606-17526628 ACAAAGAGACAAGGCTGGCCGGG + Intergenic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
903815780 1:26063445-26063467 GCAAAAAGACAAGCCTGGAAAGG - Intronic
904554113 1:31346759-31346781 ACAAGGAGAGAAACGTGGAAAGG - Intronic
905241793 1:36586353-36586375 GCAAAGAGGCCAACCTGGGGAGG - Intergenic
905812958 1:40926405-40926427 ACAAACAAACAAACCTGGGAGGG - Intergenic
905827442 1:41036687-41036709 TCAAAGAGAAAAGCCTGGAAAGG - Intronic
906764148 1:48411104-48411126 ACAGAGAGACAGAGATGGGATGG + Intronic
907045738 1:51299012-51299034 AGAAAGAAGCAAACCTTGGAAGG + Intronic
907304410 1:53505806-53505828 GCAAACAGAGAAAACTGGGAGGG - Intergenic
907327955 1:53653093-53653115 CCAAAGAGACAAACCCAGGCTGG + Intronic
907769582 1:57447199-57447221 TCAAAGAGACACATTTGGGATGG + Intronic
907946471 1:59140524-59140546 AAAAAGAAACAAAGCGGGGAGGG + Intergenic
908793877 1:67811872-67811894 CCAAGGAGACAATCATGGGAGGG + Intronic
910017881 1:82549925-82549947 ACACAGAGACAAGTCTGGGCTGG - Intergenic
910396494 1:86799316-86799338 CCAAAGAGACCAAGATGGGAAGG + Intergenic
911367906 1:96961747-96961769 ACAAGGAGAAGAACCTGTGAGGG + Intergenic
911477820 1:98395382-98395404 ACAAAGAGGCCAACCTGCAAAGG - Intergenic
912146654 1:106802579-106802601 AAAAAGAGACAAAAATGGAATGG - Intergenic
912177575 1:107179073-107179095 ACAAAGAGAAGACCCAGGGAGGG + Intronic
912242929 1:107929935-107929957 ACAGAGAGACAAACTTTGCATGG + Intronic
912471074 1:109907277-109907299 AGAAAGAGAGAAAGGTGGGAAGG + Intergenic
913348332 1:117830054-117830076 ACAAAAAGAAATACCTGAGACGG - Intergenic
914825211 1:151134534-151134556 ACAAAAGGCCAAGCCTGGGATGG + Intronic
915541319 1:156568510-156568532 ACAAACAGAAAAACCTGGATGGG - Intronic
917520077 1:175740969-175740991 GCAAAGAGAGAACCCTGGGCTGG - Intronic
917713671 1:177712121-177712143 ACAAGGAGACAAACATGAGTTGG + Intergenic
917929031 1:179811286-179811308 ACTCAGAGACAAAACTGGGAAGG + Intronic
918133360 1:181647778-181647800 ACAAAGGGACACACCTCGGCAGG - Intronic
919715912 1:200776524-200776546 AGAGAGAGAGAAACCTGGGCAGG + Intronic
920184217 1:204150588-204150610 ACAATGTGACAGAGCTGGGAGGG + Intronic
920413531 1:205781713-205781735 ACAAAGAGACAAAGCAGATATGG - Intergenic
920955100 1:210612396-210612418 ACAAAGGGACAAACATTGTATGG - Intronic
921688047 1:218113119-218113141 ACAAGGAGAAAAACCTGAGCAGG + Intergenic
922227177 1:223655664-223655686 ACAAAGAGAGAAAAATGAGAAGG + Intronic
922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG + Intergenic
923821601 1:237449414-237449436 ACAAAGTGCGAAAACTGGGAGGG - Intronic
923876404 1:238053894-238053916 ACAAAGAGAGAAATCTGGCATGG + Intergenic
924259664 1:242216334-242216356 ATAGAGACACAAACCTTGGAAGG + Intronic
924655242 1:245968823-245968845 AGAAAGACACAGACCTGAGAAGG - Intronic
1063190258 10:3687128-3687150 ACAAACAAAAAAACCTGGGTAGG - Intergenic
1063331216 10:5161414-5161436 CAAAAGAGAGATACCTGGGATGG - Intergenic
1063413527 10:5854918-5854940 ATAAAGATACAAACCAGGCACGG + Intergenic
1063916400 10:10887108-10887130 ACAATGCTACAAATCTGGGAAGG - Intergenic
1065669667 10:28102695-28102717 ACAAAGTGGCAAACCAAGGATGG - Intronic
1067072259 10:43141874-43141896 ACAAAGAAACAGACCAGAGAGGG - Intronic
1067373577 10:45707024-45707046 AGAAAGACATACACCTGGGATGG + Intergenic
1067380112 10:45765195-45765217 AGAAAGACATACACCTGGGATGG - Intronic
1067444352 10:46331351-46331373 ACGAACAAACAAACATGGGAGGG - Intergenic
1067881399 10:50048795-50048817 AGAAAGACACACACCTGGGATGG + Intergenic
1067887811 10:50105850-50105872 AGAAAGACATACACCTGGGATGG - Intronic
1067913372 10:50370450-50370472 ACAAAGACACAAGCCAGGCATGG + Intronic
1068019331 10:51561515-51561537 ACATAGAAACAAACATGGAAGGG - Intronic
1068118809 10:52763322-52763344 ATAAAAAGACAGAACTGGGAAGG - Intergenic
1068756169 10:60656475-60656497 ACAAAAAGACAAACCATAGAGGG - Intronic
1070613926 10:77954279-77954301 ACAAAAAGACAAAATTGGGCTGG - Intergenic
1071434681 10:85636087-85636109 ACCATGAGAGAAACCTGGCATGG - Intronic
1073128145 10:101165452-101165474 ACAAAAAGACAAACATTGCATGG - Intergenic
1074143921 10:110700204-110700226 ACAAAGACACAGAAATGGGAGGG - Intronic
1074718805 10:116247200-116247222 AGAAGGAGAGAAACCAGGGATGG - Intronic
1074987409 10:118670332-118670354 ACACAGCAACAAACCTGGCATGG + Intergenic
1075201462 10:120408216-120408238 ACAAAGATCCACAACTGGGATGG + Intergenic
1077212966 11:1382039-1382061 ACAAGGAGGGAAGCCTGGGAAGG - Intergenic
1078025975 11:7696073-7696095 ACAAATAGACAACCATGAGAAGG - Intronic
1078387147 11:10902617-10902639 ACAAAGGGACAAACGTTGTATGG - Intergenic
1078525162 11:12095108-12095130 ATAAGGAGACAGAGCTGGGACGG + Intronic
1078642327 11:13108388-13108410 AGGAAGAGACAAACATGGGCTGG + Intergenic
1079368751 11:19832104-19832126 ATAAAGAGAAAAAGATGGGAAGG + Intronic
1079372306 11:19861995-19862017 ACAAAGAAAGCAACCTGGGAGGG - Intronic
1081697054 11:45120181-45120203 ACACAGAAATAAAGCTGGGAGGG + Intronic
1083334094 11:61912861-61912883 ACACAGAAACAAAGATGGGAAGG + Intronic
1083338001 11:61938243-61938265 ACAAACAAAAAAACCTGGTATGG + Intergenic
1083488416 11:62997708-62997730 AAAAAGATGCAAAGCTGGGATGG - Intronic
1084488154 11:69463222-69463244 ACCCAGAGGCAAAGCTGGGATGG + Intergenic
1085030800 11:73269843-73269865 GGAAAGAGACAAGGCTGGGAAGG - Intronic
1085927612 11:81039966-81039988 GGAAAGATACAAACCTTGGAAGG + Intergenic
1086873821 11:92071211-92071233 ACAAAGCAACAAACCAGTGATGG + Intergenic
1087547124 11:99598489-99598511 ACAAAGAGACAAAGAAAGGAAGG - Intronic
1090249975 11:125244415-125244437 ACCAAGAGACAGATCTGGAAGGG - Intronic
1090250572 11:125248010-125248032 AGACACAGACATACCTGGGATGG - Intronic
1090509127 11:127353745-127353767 ACAAATAGACAAACCAGAAATGG - Intergenic
1093080140 12:14801415-14801437 AAAAAAAGAAAAACCTGTGAAGG + Exonic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1095184115 12:39180853-39180875 TCAAAGAAACAAAACTGAGATGG + Intergenic
1095889982 12:47227121-47227143 ACAAACAGAAAAACCTGAAATGG - Intronic
1098218468 12:68244004-68244026 ATAAAGAGACACACCAGGAATGG - Intergenic
1098289595 12:68945283-68945305 ACAAAGAGCTAACCATGGGAGGG - Intronic
1098389655 12:69956112-69956134 AAAAAAAAACCAACCTGGGAGGG - Intronic
1101194023 12:102364252-102364274 ACACAAAGACAAAACAGGGATGG + Intergenic
1101748205 12:107560372-107560394 ACAAAAGGAGAACCCTGGGAGGG + Intronic
1104638697 12:130453579-130453601 ACAGAGATACAAACATGGCACGG + Intronic
1104667938 12:130660679-130660701 CCAAAGAGCCGAACCTGGGGTGG - Intronic
1105318062 13:19286861-19286883 AAAGAAAGAAAAACCTGGGAGGG + Intergenic
1105879178 13:24588632-24588654 AGAAAAAGACAATTCTGGGAAGG - Intergenic
1105920660 13:24960417-24960439 AGAAAAAGACAATTCTGGGAAGG + Intergenic
1107058377 13:36130814-36130836 ACAACGCGAAAAGCCTGGGAGGG + Intronic
1108258923 13:48637725-48637747 TAAAGGAGACAGACCTGGGACGG + Intergenic
1108731752 13:53242587-53242609 AAAAAGAGACACAGCTAGGAAGG - Intergenic
1109280458 13:60349650-60349672 ACAGACAGACAGACCTGGGACGG + Intergenic
1110015209 13:70391636-70391658 ATATAGACACAAACCTTGGAAGG + Intergenic
1110081527 13:71319954-71319976 AGGCAGAGACAAACCTTGGAAGG - Intergenic
1110144582 13:72174643-72174665 CAGAACAGACAAACCTGGGAGGG - Intergenic
1110467200 13:75815385-75815407 AGAAAGAGAAGAATCTGGGATGG + Intronic
1111933498 13:94535886-94535908 TCGAAGAGGGAAACCTGGGAGGG - Intergenic
1112121427 13:96416385-96416407 ACTAAGAGTCATACCTGGAATGG + Intronic
1113209980 13:107966239-107966261 TCAAGTAGACTAACCTGGGAAGG + Intergenic
1114925443 14:27391522-27391544 ACTAAAAGACTAACGTGGGAAGG + Intergenic
1115217825 14:31029948-31029970 AAAAAGAGATAAGCATGGGAGGG - Intronic
1115663316 14:35519029-35519051 AAAAAAAAAAAAACCTGGGAAGG - Intergenic
1117470745 14:56041917-56041939 ACAAAGTTGCAAACCTAGGAAGG - Intergenic
1117536214 14:56705572-56705594 GCAAAAAAAAAAACCTGGGAAGG + Intronic
1118309979 14:64684994-64685016 ACAAAGGTACAAAGCAGGGAAGG - Intergenic
1118601413 14:67473351-67473373 ACAAAGAGACCAAGCTGGTGAGG - Exonic
1118846937 14:69554568-69554590 ACAAACAAACGAATCTGGGATGG + Intergenic
1118918267 14:70126683-70126705 TCAAAGAGACCTAGCTGGGAAGG - Intronic
1118968519 14:70611143-70611165 ATAAAGATACAGACCTTGGAGGG + Intergenic
1119984615 14:79123251-79123273 ACACACACACAAGCCTGGGAAGG + Intronic
1120070634 14:80098704-80098726 ACAAACAGAGAAATATGGGAGGG - Intergenic
1120102796 14:80464438-80464460 AAAAAGACACAAACCTTGGAAGG + Intergenic
1120157544 14:81110366-81110388 ACACAGAGAGACACCAGGGATGG + Intronic
1120418579 14:84252825-84252847 GAAAAGAGACAAACAGGGGAGGG + Intergenic
1121047596 14:90799423-90799445 ACAAAGAGATAAACCAGAAAAGG + Intronic
1121078350 14:91087951-91087973 ACAATGAGACAGCCCAGGGATGG + Intronic
1124636916 15:31371405-31371427 CCAAAGTGACCAACCAGGGACGG - Intronic
1126425800 15:48525822-48525844 AAAGAGAGAGACACCTGGGATGG + Intronic
1126960182 15:53984232-53984254 AAAAAGAGATAAAGCTGGGAAGG - Intergenic
1127351977 15:58162285-58162307 ACGAAGAGAGAACCCCGGGAGGG + Intronic
1127854317 15:62942162-62942184 ATAAGGAAACAGACCTGGGAAGG + Intergenic
1128693570 15:69743887-69743909 ACACAGGGACAAACGTGGAAGGG + Intergenic
1129591860 15:76922450-76922472 ACAAATAGACAAACATTGTATGG - Intergenic
1129875785 15:78974349-78974371 ACAAAGAGACAAAGGTAAGATGG - Intronic
1130419543 15:83730402-83730424 ACAAAATTCCAAACCTGGGATGG + Intronic
1130626907 15:85524764-85524786 AAAAAGAGAGAAAACTGAGATGG - Intronic
1131426647 15:92350775-92350797 AGAAAGTGACAGACCTGGGAGGG + Intergenic
1133911442 16:10069897-10069919 AAAGAGAGAAAGACCTGGGAAGG + Intronic
1134338166 16:13320368-13320390 ACAAAGAGAGAAACCTGAATTGG - Intergenic
1134506490 16:14811795-14811817 ACACAGAGAGACACCAGGGATGG - Intronic
1134574064 16:15316970-15316992 ACACAGAGAGACACCAGGGATGG + Intergenic
1134728356 16:16439331-16439353 ACACAGAGAGACACCAGGGATGG - Intergenic
1135288090 16:21211293-21211315 CCCAAGAGACATACCTGGAAAGG + Exonic
1135476963 16:22785280-22785302 AGATAGAGAAAACCCTGGGAAGG + Intergenic
1136746819 16:32597953-32597975 ACACAGAGAAAAAGCTAGGATGG - Intergenic
1136996902 16:35196714-35196736 ACAAACAGACAAACATCTGAGGG + Intergenic
1137313286 16:47287691-47287713 AAAAACAGACAACCCTGGTATGG - Intronic
1137409632 16:48217022-48217044 ACAAGGAGACAGATCTGGGCTGG + Intronic
1138627043 16:58260740-58260762 ACAAGGACACAAAACTGGGCAGG + Intronic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1140774888 16:78240455-78240477 ACGAGGAGAGAAACCTGGCACGG + Intronic
1141301810 16:82822978-82823000 ACAGAGAGACAAACCTCTGAGGG + Intronic
1141884899 16:86884728-86884750 ACAAAGAAAAAGACCTGGGAGGG - Intergenic
1142923969 17:3216346-3216368 ACAAAGAGACAACCGTGAGGTGG - Exonic
1143344615 17:6240720-6240742 GCAAAGAGTCAAACTTTGGAAGG - Intergenic
1143618586 17:8068149-8068171 ACAGAAAGACAAACTTGAGAGGG - Intergenic
1144874731 17:18391443-18391465 ACACAGAGCCAAACCTGTGAGGG - Intergenic
1144953224 17:19004872-19004894 ACAGACAGACAGACCTGGGGCGG + Intronic
1145157494 17:20552978-20553000 ACACAGAGCCAAACCTGTGAGGG + Intergenic
1146159300 17:30551272-30551294 ACACAGAGCCAAACCTGTGAGGG - Intergenic
1146579702 17:34025907-34025929 ATAAAGACACAATCCTGGTAAGG - Intronic
1146845290 17:36178537-36178559 ACACAGAGCCCAACCTGTGAGGG + Intronic
1146848670 17:36202580-36202602 AAAAAGAGACAAAACTAGGCCGG - Intronic
1146873506 17:36390380-36390402 ACACAGAGCCCAACCTGTGAGGG + Intronic
1146880864 17:36441468-36441490 ACACAGAGCCCAACCTGTGAGGG + Intergenic
1147065882 17:37922493-37922515 ACACAGAGCCCAACCTGTGAGGG - Intergenic
1148668479 17:49392419-49392441 AAAAAGATACAAACCTAGGCTGG - Intronic
1149361659 17:55901721-55901743 GCAAAGAGTTAAAGCTGGGAGGG + Intergenic
1149848425 17:60021031-60021053 ACACAGAGCCAAACATGTGAGGG + Intergenic
1149861744 17:60125493-60125515 ACACAGAGCCAAACATGTGAGGG - Intergenic
1150086773 17:62277598-62277620 ACACAGAGCCAAACATGTGAGGG + Intronic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1151219376 17:72600893-72600915 ACAAAGAGAGAGAATTGGGAGGG - Intergenic
1151311353 17:73294372-73294394 ACAAAAAAACAAACCCAGGATGG + Intronic
1154254628 18:12771736-12771758 ACAAAGGGACATTTCTGGGATGG - Intergenic
1155095630 18:22552768-22552790 ACAAATAGACAAACTTTGAAAGG + Intergenic
1155837217 18:30600975-30600997 ATCAACAGACAAACCTGGGTTGG - Intergenic
1156167777 18:34443834-34443856 ACAAGGAGACAAAAGTGGCAAGG + Intergenic
1157061093 18:44291476-44291498 ACAAAGAGAGAATCCTGGACAGG - Intergenic
1158516824 18:58137856-58137878 AGAAAAAGACAAAGCTGGGCAGG - Intronic
1158692834 18:59676720-59676742 ACAAAGACAAAAACCTGAAATGG + Intronic
1159173650 18:64806130-64806152 ACAAAGAGATAAGCCAGAGATGG - Intergenic
1160581814 18:79887497-79887519 TCACAGAGACAGACGTGGGAGGG + Intronic
1163501294 19:17678053-17678075 ACAGAGATACAAACCCGGGATGG - Intronic
1163779462 19:19239018-19239040 AAAAAGAAACAAATCAGGGAAGG - Intronic
1164526750 19:29018669-29018691 ACAAGGAGACAGCCTTGGGAAGG + Intergenic
1164613521 19:29650090-29650112 ACAAAGAGTCAAACTTGGCCAGG + Intergenic
1165432688 19:35781531-35781553 AGGAAGAGACAAACAGGGGAGGG + Intronic
1165891285 19:39113718-39113740 ACAGAAAGACAAACCTCGCATGG + Intergenic
1167176747 19:47869832-47869854 ACAAGAAGACAAACCAGAGATGG - Intergenic
1167494079 19:49807848-49807870 ACAAAGAAAGGGACCTGGGATGG - Intronic
1168545272 19:57244784-57244806 ACAAACAGTAAAACCTGGGGTGG - Intronic
925454541 2:4003996-4004018 ACAAGTATACTAACCTGGGAGGG + Intergenic
926199798 2:10786359-10786381 ACAATGAGAGAGAGCTGGGAGGG + Intronic
926772992 2:16394432-16394454 ACACAGAGAGAAGCCTGGGGAGG - Intergenic
927078656 2:19605612-19605634 ACAGAGAGAGAAACATGTGAGGG + Intergenic
928782379 2:34839693-34839715 ACAAAAAGACAAATATGGCATGG + Intergenic
929693367 2:44093035-44093057 AGAAAGAGACAGTCCTGGGTGGG - Intergenic
929737674 2:44567636-44567658 AGACAGAGACAGACATGGGAAGG + Intronic
930828212 2:55715719-55715741 ACAAACAAACAAACATGGCAAGG + Intergenic
931455975 2:62410070-62410092 ACATAGGGGCAAACCTGGCAGGG - Intergenic
932680569 2:73821266-73821288 ACAAAGATAAAAATCAGGGAGGG - Intergenic
933420355 2:82037726-82037748 AGAAAGAGACAGGCCTGTGATGG + Intergenic
933977697 2:87525191-87525213 ACAAGGTTAGAAACCTGGGATGG - Intergenic
934136191 2:88998566-88998588 ACATAGAGACAGAACTGGAATGG - Intergenic
935301852 2:101699229-101699251 AAAAAGAGAAAGACCTGGGTGGG - Intronic
935920665 2:108009835-108009857 ACAAAGAGATAAACTAGGGATGG + Intronic
936316134 2:111425616-111425638 ACAAGGTTAGAAACCTGGGATGG + Intergenic
937299891 2:120832697-120832719 GAGAAGAGACAAACCTGGGCTGG + Intronic
937672544 2:124553771-124553793 ACAAAGAGACAGACAGAGGAAGG + Intronic
937922930 2:127144898-127144920 ACAAAAAGACAAACCTGCCGCGG - Intergenic
937953018 2:127402631-127402653 ACAAACAGCCATACCTGGGCAGG - Intergenic
938616770 2:133007411-133007433 AAAAAGAGACAAAGCAGGTAGGG - Intronic
939541431 2:143498783-143498805 TCACAGAGACATTCCTGGGAGGG + Intronic
939624144 2:144456096-144456118 ACAATGGAACAAACTTGGGATGG - Intronic
939654829 2:144811157-144811179 ACAAAGAGAGAACCCAGGAAAGG + Intergenic
940330586 2:152470056-152470078 ACACAGACACAAAGCAGGGAGGG - Intronic
940654838 2:156475594-156475616 AGAAAGGGAAAAACTTGGGAAGG + Intronic
940799314 2:158115872-158115894 GCAGAGAGACAAACATGGGAAGG - Intronic
941015226 2:160348451-160348473 ACAAAGAGACATACCCTAGAAGG + Intronic
941081970 2:161072166-161072188 ACAAAGACATACACCTGGCAGGG - Intergenic
941149374 2:161894817-161894839 TCAAATATACATACCTGGGAAGG - Exonic
943737079 2:191368005-191368027 ACAAATAAACAAACAAGGGAGGG - Intronic
944377026 2:199057501-199057523 GCAAAGGGAGAAAACTGGGAGGG + Intergenic
944606352 2:201354992-201355014 ACAAAGAGAAAAAGATGGTATGG + Intronic
945085161 2:206124101-206124123 ACAAAGAAATAAACCTGTAAAGG + Exonic
945567710 2:211423368-211423390 GCAAAGAAACAAACTTGTGAAGG - Intronic
947561592 2:231158659-231158681 ACATAGTAACTAACCTGGGATGG - Intronic
948140132 2:235666677-235666699 GCAAAGTGCAAAACCTGGGATGG + Intronic
948830583 2:240596655-240596677 CCAAGAAGACAAACATGGGAGGG - Intronic
1169491545 20:6075613-6075635 ACATAGAGACAGACTTGGCAAGG - Exonic
1169511570 20:6269519-6269541 ACAAACATACAAACCAGTGAAGG - Intergenic
1171029825 20:21667569-21667591 ATAAAGAGACAAACCTCAGAGGG - Intergenic
1172086423 20:32387329-32387351 ACAAATAGAAAAGCCTGGGCTGG - Intronic
1172130801 20:32653449-32653471 GCAAAGAACCAAGCCTGGGAGGG - Intergenic
1172210879 20:33197699-33197721 AGAGACAGACAGACCTGGGATGG - Intergenic
1172215948 20:33235794-33235816 AAACAGAGAAAAACCTGAGATGG - Intergenic
1172776550 20:37410829-37410851 AGAAAGAGACAAACCTGTTATGG - Intergenic
1173410591 20:42806188-42806210 ATAAAAAGACAAACCTGGCCAGG + Intronic
1174157866 20:48528424-48528446 GGAAAAAGACAAAGCTGGGAAGG + Intergenic
1174572385 20:51511250-51511272 ACAAACAGACAAGCCCAGGAGGG - Intronic
1174736819 20:52972811-52972833 AAAAAAAGGCAATCCTGGGAAGG - Exonic
1174970811 20:55273617-55273639 ACATAGAGAGAAACCAAGGATGG - Intergenic
1175028392 20:55927796-55927818 ACAAACAAACAACCCTGGAAGGG + Intergenic
1175412636 20:58781039-58781061 AGAGGGAGACAAACGTGGGAAGG - Intergenic
1175482280 20:59320240-59320262 TCAAAGAGACAAACATCAGAAGG - Intronic
1177474513 21:21602377-21602399 ACAAACAGAAAAAGCAGGGAAGG + Intergenic
1177711300 21:24778522-24778544 ACAAAGAGAAAAATGTAGGAAGG - Intergenic
1177957159 21:27613042-27613064 CCAAAGAGAAAAATATGGGAAGG - Intergenic
1178094219 21:29197072-29197094 CCACAGAGATAAATCTGGGAAGG + Intronic
1178137874 21:29648743-29648765 AAAGAGAGAAAAACCAGGGAGGG + Intronic
1179299070 21:40090311-40090333 ACCAAGAGAAGAAGCTGGGAGGG - Intronic
1182388743 22:29971618-29971640 TTAAAGAGACAAAACAGGGAAGG - Intronic
1184378192 22:44128360-44128382 AGAAAGAGAGAAAACTGGGGAGG - Intronic
1185204947 22:49532423-49532445 AGATAGAGACACACCTGGGTGGG - Intronic
950137563 3:10592449-10592471 AGAAAAGCACAAACCTGGGATGG - Intronic
950368901 3:12510522-12510544 ACAAAGGGACACACCAGGGTCGG + Intronic
950649131 3:14396387-14396409 AGAAGGAGCCAGACCTGGGAAGG + Intergenic
950818150 3:15729268-15729290 ACAAAGACACAGAGGTGGGAAGG - Intronic
951552347 3:23886576-23886598 ACCAAAAGAAAAACCTGTGATGG + Intronic
952208445 3:31204078-31204100 AGATAGAGACAAATCTGGCAAGG + Intergenic
952286408 3:31973568-31973590 AAAAGGAGACAAAGCTGGAAAGG + Intronic
953114540 3:39979123-39979145 ACAAACAAACAAAACTGGGTTGG - Intronic
955871398 3:63442224-63442246 ACAAAGAGACAGAGATAGGAAGG + Intronic
956362276 3:68461305-68461327 ACAAACAAACAAACCTGGCCAGG + Intronic
957171557 3:76743829-76743851 ACCAGGAGGCAAACCTGAGAAGG + Intronic
957327553 3:78716032-78716054 ACACAGACACAAAGCTGAGAAGG - Intronic
957722821 3:84026232-84026254 CCAAGGCTACAAACCTGGGAAGG + Intergenic
958979569 3:100705643-100705665 ACACAGAGAGAAACCAGAGATGG - Intergenic
959658711 3:108841176-108841198 ACAAAGATACAAAGATGGAAAGG + Intronic
961142329 3:124565959-124565981 GGCAAGAGACAAAGCTGGGAGGG + Intronic
961580277 3:127875209-127875231 CCAAGGAGAAAAGCCTGGGATGG - Intergenic
962188213 3:133282352-133282374 ACAACTAGGAAAACCTGGGAAGG - Intronic
963096395 3:141545946-141545968 ACAGAAAGACAAACCTCGTATGG - Intronic
963238522 3:142979720-142979742 ACTAAGATACAAAACTGAGATGG - Intronic
964381610 3:156103384-156103406 ACAAACAAACAAATGTGGGAGGG + Intronic
965468961 3:169066298-169066320 AAAAAGGGAGAAAACTGGGACGG - Intergenic
968485758 4:860601-860623 ACCAGGAGACAAACCGGAGATGG + Intronic
969498181 4:7538097-7538119 ACAGAGAGGCAGACCTGGCAAGG - Intronic
970189490 4:13499572-13499594 ACATGGAGAATAACCTGGGAAGG + Intergenic
970244241 4:14041822-14041844 AGAAAGAGACATACCTTTGAGGG - Intergenic
971801268 4:31294821-31294843 ACACAGAGACAGACATGTGAGGG - Intergenic
975866086 4:78725007-78725029 ACAATGAGACAAACCCTGAAAGG - Intergenic
976920900 4:90441708-90441730 TGTAAGAGACAAACGTGGGAGGG + Intronic
977350004 4:95871699-95871721 ACAAAGAAACAAATCTGCGAGGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
981119315 4:141030707-141030729 ACAAAAAGACAAATATGGTATGG + Intronic
982043822 4:151421793-151421815 ACAAAGGCACAGACCTAGGAAGG - Intronic
982524555 4:156461462-156461484 AAAAAGAAACAAAACTGGCAGGG - Intergenic
983761542 4:171413694-171413716 ACAAACAAACAAGCCTGGCATGG + Intergenic
983859024 4:172681190-172681212 AAAAAGGAACAAACCTGGGGAGG - Intronic
984208640 4:176818030-176818052 ATGAAGAGATAAAGCTGGGAGGG - Intergenic
985658383 5:1143650-1143672 ACACAGGGAGAACCCTGGGAAGG - Intergenic
986657903 5:10033365-10033387 ACTAAGAGATAAACCAAGGAGGG + Intergenic
986687907 5:10290033-10290055 ACAAAGAGGTAAACTTGGGGAGG + Intronic
987759181 5:22137306-22137328 ACTATAAGACAAAGCTGGGAAGG - Intronic
987790341 5:22558153-22558175 GCAAAGAGATAAACCAGAGAAGG + Intronic
989483235 5:41957290-41957312 ACAAAGAGAAAAAACTGTAAAGG - Intergenic
991005544 5:61824625-61824647 CAAGAGAGACAAGCCTGGGAAGG + Intergenic
991444941 5:66689485-66689507 AGAAAGAGAAACACCTGGGAAGG - Intronic
991618905 5:68525087-68525109 ACAAAGAGACACATCAGGTAGGG - Intergenic
991893893 5:71370753-71370775 ACGATAAGACAAAGCTGGGAAGG - Intergenic
994348482 5:98716755-98716777 AGAAACAGACAAACCTGGCCGGG + Intergenic
994968370 5:106703083-106703105 AGAAAGAGAAAAACATGGAAAGG - Intergenic
996681666 5:126234178-126234200 ACAAACAAACAAACCTGGATAGG + Intergenic
996787037 5:127249481-127249503 ACAAACATACAAACATGAGATGG + Intergenic
996982344 5:129514032-129514054 ACAAAAAGACAAACATGGGATGG - Intronic
997296461 5:132771863-132771885 CCAAGGAGACATACGTGGGAGGG + Intronic
997356812 5:133267672-133267694 AAACTGAGACACACCTGGGAAGG + Intronic
997826227 5:137109244-137109266 ACAAAGAGAGAAACATTGCAAGG + Intronic
997857441 5:137384751-137384773 ACACAGAGACAAAGAGGGGAAGG - Intronic
998402863 5:141856974-141856996 AGAACGTGACAGACCTGGGAGGG - Intronic
998409442 5:141898098-141898120 GAAAAGAAAAAAACCTGGGAAGG + Intergenic
998964293 5:147522223-147522245 ACAAAGAGCAAAATCTGGGTGGG + Intergenic
1000285351 5:159821670-159821692 ACAAAGGGACTAACCCTGGATGG + Intergenic
1001486452 5:172123079-172123101 CCAAAAAGAGAAACCTGGAATGG + Intronic
1001838465 5:174852815-174852837 ACAAAGAGAGGAAACTGGGAGGG + Intergenic
1003334683 6:5159298-5159320 ACAAAGGGACAAGCCTAGAAGGG + Intronic
1003520000 6:6850364-6850386 ACAAGGACACAAAAGTGGGAGGG + Intergenic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1004726005 6:18311915-18311937 ACAAAGAAACAGGCCTGGTATGG - Intergenic
1005956368 6:30666135-30666157 ACAAAGATAGAAACCAGTGAGGG + Intronic
1005996226 6:30933053-30933075 ACAAAGAGACACACCAGCCATGG + Intergenic
1006069009 6:31483946-31483968 ACAAATTGACAAACCTGGGTAGG - Intergenic
1006107587 6:31725712-31725734 AGAAAGGGACAAACCTAGAATGG - Intronic
1006437587 6:34034214-34034236 ACAATGAGAGGAGCCTGGGAGGG - Intronic
1007198774 6:40087392-40087414 AGAAAGAGAGAGAACTGGGAAGG + Intergenic
1007374104 6:41444582-41444604 CTATAGAGACAAAGCTGGGAAGG + Intergenic
1007716542 6:43859360-43859382 ACTAAGAGACAGAACCGGGAAGG - Intergenic
1008241754 6:49121816-49121838 ACAAAGGGAAAAACATGGTAGGG + Intergenic
1008567427 6:52783024-52783046 ACAAAGAAAACAACCTGGAATGG + Intergenic
1008570861 6:52815341-52815363 ACAAAGAAAACAACCTGGAATGG + Intergenic
1008576882 6:52869214-52869236 ACAAAGAAAACAACCTGGAATGG + Intronic
1010398387 6:75419249-75419271 ACAAAAATACAAATCTGGAAAGG - Intronic
1010777823 6:79907078-79907100 ATAAAGAAACAAACAAGGGATGG + Intergenic
1011967559 6:93177928-93177950 ACAAACAAACAAACCTGACAAGG - Intergenic
1012923142 6:105240460-105240482 ACAAAAACATAAACCAGGGAAGG + Intergenic
1013377042 6:109527316-109527338 GCAAGAAGACAAACCTGGGAAGG + Intronic
1014857518 6:126420145-126420167 AAAAGGAGCCAAACCTGGGATGG + Intergenic
1014929099 6:127311718-127311740 AGAAAGAAAGAAAACTGGGATGG + Intronic
1015018964 6:128448829-128448851 ACAAACAAACAAAACTGGCATGG - Intronic
1015193900 6:130504495-130504517 ACAAAGAGACAACCCACAGAAGG + Intergenic
1016189291 6:141241917-141241939 ACAAATAAACAAATGTGGGATGG + Intergenic
1017255359 6:152327283-152327305 ACAAACAAACAAACATGGAAAGG + Intronic
1018225759 6:161627050-161627072 AGAAAGATGCAAACCTTGGAAGG - Intronic
1018230195 6:161667872-161667894 AGAGTGAGAAAAACCTGGGAGGG + Intronic
1021065344 7:16166093-16166115 ACACAAAGTCAAACCTGTGAGGG + Intronic
1021120914 7:16794745-16794767 AAAAACAAACAAACCTGAGATGG + Intronic
1021272142 7:18602911-18602933 ACAAATAGACAAACCTATTACGG - Intronic
1023380033 7:39598103-39598125 ACAAACAAACAAACTTGGCAGGG - Intronic
1023547039 7:41328911-41328933 ACTGAGAGACTAACTTGGGAGGG + Intergenic
1023753464 7:43393999-43394021 AGAAAGAGACAAATTTGGGGTGG + Intronic
1024964239 7:55007470-55007492 TCATTGAAACAAACCTGGGAGGG - Intergenic
1026637134 7:72094062-72094084 GCTTAGAGACAAACCTGGTAGGG - Intronic
1027238963 7:76314962-76314984 ACAAAGAGACAAGCCGGACATGG + Intergenic
1028596709 7:92553694-92553716 ATAAAGACAGAAAGCTGGGAGGG + Intergenic
1028627284 7:92891332-92891354 ACAAAAAGACAAACATGGCATGG + Intergenic
1029365643 7:100114412-100114434 AGAAAGATACAAATCTGGGCTGG + Intronic
1030106417 7:105990993-105991015 GCAAATAGAGAAACCTGGGGTGG + Intronic
1031187226 7:118498187-118498209 ACAAACAGACAAAACTGTCAGGG - Intergenic
1031955937 7:127942479-127942501 ACAATGAGGCAAGCCTAGGAAGG - Intronic
1032399065 7:131611065-131611087 ACCAAGGTACAGACCTGGGAGGG - Intergenic
1032434420 7:131888426-131888448 CTATAGAGAGAAACCTGGGAGGG - Intergenic
1034225711 7:149479252-149479274 ACAAAGAGAAAAACCTTAAAAGG + Intronic
1034829841 7:154299464-154299486 ACAAAAAGACCAAGTTGGGATGG - Intronic
1035181561 7:157093084-157093106 ACAGAGAGAGAAGCCTGGCATGG + Intergenic
1035332149 7:158103261-158103283 CCAAAGATACAGGCCTGGGATGG + Intronic
1035527948 8:328600-328622 ATAAAGAGCCAACCCAGGGAGGG + Intergenic
1035847877 8:2884536-2884558 ACAAAGAGACAAACCTAGCCAGG - Intergenic
1037110366 8:15158235-15158257 ACAGAAAGAGAAACCTGGTATGG - Intronic
1037510972 8:19582277-19582299 ACCAACAGACAAACCTGGTAAGG + Intronic
1037642758 8:20763008-20763030 AGAATGAGACAAACTAGGGAGGG - Intergenic
1037699234 8:21257773-21257795 AAAAAGAAACAAAGCTGGAATGG + Intergenic
1038488923 8:27955598-27955620 AAACAGAGACAGACCAGGGAGGG + Intronic
1038513047 8:28158625-28158647 ATGAAGAGACTAACCTGGTATGG - Exonic
1039394001 8:37207225-37207247 ATGAAGCCACAAACCTGGGACGG - Intergenic
1041082536 8:54227109-54227131 ACAAAGAGACAGACCTATGTAGG - Intergenic
1042651707 8:71049786-71049808 ATAAAGAGAGAAAAATGGGAGGG + Intergenic
1043239249 8:77911571-77911593 AAAAAGGGAAAAACATGGGAAGG - Intergenic
1043686003 8:83086738-83086760 ACAAACAAACAAATCTGGAAGGG + Intergenic
1044179847 8:89178280-89178302 AAATAGACACAAACCTTGGAAGG + Intergenic
1044248268 8:89976321-89976343 AGAAAGATGCAAACCTTGGAAGG + Intronic
1044635876 8:94323425-94323447 AGAATGGGACAAACCTTGGAAGG + Intergenic
1045046319 8:98282331-98282353 ACAAAGATACAAACTAGAGAAGG + Intronic
1047300822 8:123612239-123612261 ACAAAGAGAAAAAGAAGGGAAGG - Intergenic
1049007584 8:139865482-139865504 AGAAAGAGCCACCCCTGGGATGG + Intronic
1049337428 8:142093865-142093887 GAAAAGAGAGAAACCTGGGAGGG + Intergenic
1050187894 9:2994428-2994450 AAAAAGAGACAGAGATGGGAGGG + Intergenic
1051966809 9:22837859-22837881 ACAATGAAACAAACCTGAGGTGG - Intergenic
1052729339 9:32266731-32266753 ACAACCACACAAACCTGGCAAGG + Intergenic
1052729554 9:32269166-32269188 ACAACCACACAAACCTGGCAAGG + Intergenic
1053365762 9:37521432-37521454 TCAAAGATGCAAACCTGGGTAGG - Intronic
1053616011 9:39766622-39766644 ACTAAGAGACAAAGTTGGGATGG - Intergenic
1053796211 9:41729106-41729128 ACATAAGGATAAACCTGGGATGG + Intergenic
1053874184 9:42525932-42525954 ACTAAGAGACAAAGATGGGATGG - Intergenic
1053898436 9:42768653-42768675 ACTAAGAGACAAAGATGGGATGG + Intergenic
1054184616 9:61941176-61941198 ACATAAGGATAAACCTGGGATGG + Intergenic
1054237506 9:62575768-62575790 ACTAAGAGACAAAGTTGGGATGG + Intergenic
1054268149 9:62940822-62940844 ACTAAGAGACAAAGATGGGATGG + Intergenic
1054551642 9:66610279-66610301 ACTAAGAGACAAAGTTGGGATGG + Intergenic
1054653891 9:67647321-67647343 ACATAAGGATAAACCTGGGATGG - Intergenic
1056075943 9:83040227-83040249 ACAAAAACACAAACCTGAGGTGG - Intronic
1056279249 9:85023971-85023993 AAAAAAAGACAAAACTGGAATGG - Exonic
1056457470 9:86774589-86774611 GAAAAGAGACAAACAAGGGAGGG - Intergenic
1056780583 9:89546844-89546866 ACAAGGATACAAACATGGGAAGG - Intergenic
1058822483 9:108745301-108745323 ATAAAAAGACAAAACTGGGCCGG - Intergenic
1059144512 9:111886472-111886494 ACAAACAAACAAAACTTGGATGG - Intergenic
1059837350 9:118170708-118170730 ACAGGGAGAAAATCCTGGGAAGG - Intergenic
1059976635 9:119724744-119724766 AGAAAGAGAAAAACCAGGAATGG - Intergenic
1060089694 9:120732103-120732125 GCTTAGAAACAAACCTGGGATGG - Intergenic
1061594983 9:131623115-131623137 ACGAAGAGGCAAGCCTAGGAAGG + Intronic
1185771576 X:2769035-2769057 ACAAAGTCACAAACCTTGGAGGG - Intronic
1186158200 X:6747981-6748003 AAGAAGAGAAAAACCTTGGAGGG + Intergenic
1186418187 X:9401486-9401508 CCAATGACACAAACCCGGGAAGG + Intergenic
1186893342 X:13981860-13981882 AAAGAGAGATAATCCTGGGAGGG + Intergenic
1188318368 X:28704879-28704901 AGAATGAGACAATACTGGGATGG + Intronic
1190787293 X:53663882-53663904 AAAAAAAAAAAAACCTGGGAAGG + Intronic
1191750551 X:64537432-64537454 ACAAAAGGACAAAGCGGGGAAGG - Intergenic
1193088167 X:77466058-77466080 ACAAAGAGACAACCATGGAGTGG - Intergenic
1194285120 X:92000820-92000842 ACAGAAAGACAAACATGGCATGG - Intronic
1196945346 X:120818990-120819012 ACAAAGAAAGAGACTTGGGAAGG + Intergenic
1197040052 X:121925990-121926012 ACAAAAACAAAAACCTGGTAGGG + Intergenic
1199497693 X:148471483-148471505 ACAAATGGACTAACATGGGAAGG + Intergenic
1200602689 Y:5225364-5225386 ACAGAAAGACAAACATGGCATGG - Intronic
1201298991 Y:12489994-12490016 ACAAAATTACAAACCTTGGAGGG + Intergenic