ID: 1093821807

View in Genome Browser
Species Human (GRCh38)
Location 12:23628629-23628651
Sequence TTGGATAAGAAAAAGGAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093821801_1093821807 18 Left 1093821801 12:23628588-23628610 CCTCCGTTTCTCCTTGTTCACTT 0: 1
1: 0
2: 1
3: 24
4: 294
Right 1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG 0: 1
1: 0
2: 3
3: 34
4: 438
1093821802_1093821807 15 Left 1093821802 12:23628591-23628613 CCGTTTCTCCTTGTTCACTTTCT 0: 1
1: 1
2: 6
3: 190
4: 1609
Right 1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG 0: 1
1: 0
2: 3
3: 34
4: 438
1093821803_1093821807 7 Left 1093821803 12:23628599-23628621 CCTTGTTCACTTTCTTCATTCAA 0: 1
1: 0
2: 1
3: 42
4: 510
Right 1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG 0: 1
1: 0
2: 3
3: 34
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093821807 Original CRISPR TTGGATAAGAAAAAGGAGTA CGG Intronic
904244179 1:29174614-29174636 TTGGAAAAAAAAAAGGAGTCAGG + Intronic
904573504 1:31485794-31485816 TTGAAAAAGAAAAGGGAGAAGGG + Intergenic
905596308 1:39210661-39210683 TTTGAGAAGAAAAAAGACTAAGG + Intronic
905972396 1:42152119-42152141 TGAGATAAGAAAAAGGAAGATGG + Intergenic
906706603 1:47899640-47899662 TTGAAGAAGAAAAAGGATTTTGG + Intronic
906827421 1:48996464-48996486 GTGGAGAAGAAAGAGGACTAAGG + Intronic
906853754 1:49282359-49282381 TTGTCTCAAAAAAAGGAGTAGGG + Intronic
906890039 1:49701741-49701763 TTGGCTAACAAAAAAGAGAAAGG + Intronic
908088348 1:60660631-60660653 TTGGAGAACAAAGAGGAGTCTGG - Intergenic
909027797 1:70503263-70503285 TTGGAAAACAAGAAGGATTAAGG + Intergenic
909311259 1:74152792-74152814 TTAGAAAAGTAAAAGGAGCATGG + Intronic
909529806 1:76669749-76669771 TTGGACAAGAAAAAGAGGAAGGG + Intergenic
910373169 1:86540204-86540226 TAGAATTAGAAAAATGAGTATGG + Intergenic
911715667 1:101130000-101130022 TTGGGTTAGAAAAAGGACTTTGG - Intergenic
911803329 1:102173653-102173675 TTGGAAAAGAAAAATTAGAATGG + Intergenic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
914220989 1:145681720-145681742 TTGGAAAAGAAAAGAAAGTAAGG + Intronic
914473561 1:148004597-148004619 TTGGAAAAGAAAAGAAAGTAAGG + Intergenic
916118675 1:161509783-161509805 TATGATAAGAAAAAGTTGTAAGG - Intronic
916267358 1:162904115-162904137 AAGGATAAGAAAAAGGAATTGGG + Intergenic
916524281 1:165594834-165594856 TTTGATAAGAAAAAGTTGTAAGG - Intergenic
916756277 1:167773114-167773136 TTGGATAATAAAAGAGGGTACGG + Intronic
917280066 1:173371510-173371532 TTTGATAAGGAAAAGGAGGGGGG - Intergenic
918422684 1:184379991-184380013 TTGTATTATAAAAAGGAGAAAGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919235761 1:194839973-194839995 GTGGAAAAAAAAAAGGAGTCAGG + Intergenic
919648519 1:200121591-200121613 TTGGAATAAAAAAAGGATTAAGG + Intronic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
922249407 1:223834162-223834184 TAGGTCAAGAATAAGGAGTACGG + Intronic
922985399 1:229862406-229862428 TTGGTTAAAAAAAAAGAGGAGGG - Intergenic
923176673 1:231473648-231473670 TTGGATATGAAAAATGAATGGGG + Intergenic
923909800 1:238428703-238428725 TTGGACAAGAGAAAGAAATAAGG - Intergenic
924694447 1:246383794-246383816 TGGCCTAAGAAAAAGGAGCAGGG - Intronic
1063878146 10:10501941-10501963 TTGAAAAAGAAACAGGAATAGGG - Intergenic
1065040037 10:21683900-21683922 TTAGGTAAGTAAAAAGAGTATGG - Intronic
1065742027 10:28805672-28805694 CAGGGCAAGAAAAAGGAGTAGGG - Intergenic
1066054240 10:31665656-31665678 TTGCAGAAGAAAAAGGATTTGGG + Intergenic
1067791493 10:49291802-49291824 TGGGATAAGGAAAAGGAGCTAGG - Intergenic
1067793592 10:49305183-49305205 GTGGGTAAGAACCAGGAGTATGG + Intronic
1068001691 10:51342213-51342235 TAGGATAAGTAATAGGAGAAGGG + Intronic
1068057228 10:52026234-52026256 TTCTAAAAGAAAAAGGAATATGG + Intronic
1068394226 10:56440836-56440858 TTGGACAAGAAGAAGCAATATGG - Intergenic
1068515051 10:58015490-58015512 ATGGAGAAGAAAAAGGCTTAAGG - Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1069143156 10:64854018-64854040 TTGGAAAAAAATAAGGAATATGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1071172755 10:82886288-82886310 TTGTAAAAGATAAATGAGTAAGG - Intronic
1071268343 10:83984157-83984179 GTGGATCAGAAAAGGGAGTTTGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071451570 10:85796775-85796797 TTCAATAAGACAATGGAGTAAGG + Intronic
1071737773 10:88320616-88320638 ATGGAAAACAAAAAAGAGTAAGG + Intronic
1071905589 10:90170098-90170120 TTGGATAAGAATAAGAAATATGG + Intergenic
1073066486 10:100762580-100762602 CTGCATAAGAAAAATTAGTAGGG + Intronic
1073153648 10:101329273-101329295 TTGGATAAGCAAGAGGGTTAAGG + Intergenic
1073208009 10:101778837-101778859 TTTGATAAGATAAAGGAGGGAGG - Intronic
1075014135 10:118897720-118897742 TTGGAACAGAAAGAGGAGTGGGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075415914 10:122264234-122264256 TTGGGAAAGAAAAAGAAGAATGG - Intergenic
1076073500 10:127513092-127513114 TAGGAAAAGAAAAAAGAATATGG + Intergenic
1077074253 11:693334-693356 TTGGTTAAGAAAAAAAAGTGAGG - Intronic
1077346663 11:2061504-2061526 TGGGATATAAAAATGGAGTATGG - Intergenic
1077346814 11:2063332-2063354 TTGAAGAAAAAAATGGAGTATGG - Intergenic
1078412370 11:11136719-11136741 TTGGATAAGAATCTGGAGTTAGG + Intergenic
1079726021 11:23882270-23882292 TTGGATATGAAAAACCACTAAGG - Intergenic
1080986473 11:37472922-37472944 TTAGACAAAAAAAAGGTGTATGG - Intergenic
1081227911 11:40547626-40547648 TTGGAAAAGCAAAAGCAATAAGG - Intronic
1082742375 11:56925211-56925233 TGGGATAGGAATAAGGAGTGAGG - Intergenic
1085474635 11:76782235-76782257 ATGAATAAGAAAAAGTAATAAGG + Intronic
1085484362 11:76849369-76849391 TTGGGTAAGACAAAGGAAGAAGG - Intergenic
1085876194 11:80408409-80408431 ATGGAAAACAAAAAAGAGTAGGG + Intergenic
1086595336 11:88564060-88564082 ATGGATAAGAAAAAGGGGCAGGG - Intronic
1087329171 11:96757813-96757835 TTAGGAAAGAAAAAGGAGTCAGG + Intergenic
1087445871 11:98252725-98252747 TTGGATAGGATAAAAGAGTAAGG + Intergenic
1087977596 11:104569007-104569029 TTAAAGAAGAAAAAAGAGTATGG + Intergenic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1088806866 11:113360531-113360553 TTGAATAAGAAAACTGAGAAAGG + Intronic
1088889093 11:114030707-114030729 TTGGATAAGATAGAGGAGAATGG - Intergenic
1088982371 11:114875313-114875335 TTGTTCAAGAGAAAGGAGTAGGG + Intergenic
1089574347 11:119431034-119431056 TTGGATAAATATAAGGAGTAAGG + Intergenic
1089861902 11:121597275-121597297 TTGGTTAAGAGGAAGGAGTGTGG + Intronic
1090493233 11:127184495-127184517 CTGGTTAAGAAACAGGAGTCTGG + Intergenic
1091115616 11:133010011-133010033 CTGGATATGAAAAGGGACTAGGG - Intronic
1091639145 12:2221306-2221328 GTGGATTAGAAAAGGGAGTTGGG + Intronic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1093855339 12:24094954-24094976 TTGGATAAACAAAAGGAGAGAGG - Intergenic
1094043512 12:26142510-26142532 TTCAATAAGAATAAGGAATATGG + Intronic
1094250503 12:28354648-28354670 TTTGATCAAAAAAAGGAATATGG - Intronic
1095133455 12:38569997-38570019 TTTGATAATAAAAATGAGCATGG - Intergenic
1096020215 12:48318006-48318028 TTGGGTAAGAAAAAGAACTTGGG + Intergenic
1096239660 12:49953046-49953068 TGGGATAAGAAAATGGATTCTGG - Intronic
1096483794 12:51962178-51962200 TTGCATAAGAGAAAGGTGTTTGG - Intronic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1098512522 12:71334019-71334041 TGGGATAATAAAAAGAAGTGAGG + Intronic
1098725565 12:73961638-73961660 TTTGATTAGAATAAGTAGTATGG - Intergenic
1099598116 12:84694700-84694722 TTGGGTAAGAAAACAGAGCAGGG - Intergenic
1100030449 12:90182391-90182413 TTGGATGAGAAAAAGATGTTTGG + Intergenic
1100398892 12:94210298-94210320 TTGGATGAGAGAAGGGAGCAAGG + Intronic
1100445411 12:94655642-94655664 TTGGATTAAAAGTAGGAGTAGGG - Intergenic
1100530020 12:95454367-95454389 TTTGATAAGGAAAAGTGGTAGGG + Intergenic
1100569546 12:95834667-95834689 TTGGAAAAGAGAAGGGAGTTAGG - Intergenic
1101829014 12:108242787-108242809 TTGAATAAGGAAAAAGAGTGGGG - Intronic
1102728702 12:115089172-115089194 TCGGATCAGAAAAAGGATGAAGG - Intergenic
1102733722 12:115138420-115138442 CTGGATAAGTCAAAGGAGTCCGG - Intergenic
1102850207 12:116235678-116235700 TGAGTTAACAAAAAGGAGTAGGG - Intronic
1103673466 12:122637460-122637482 ATGGATAAGAAAAGGGACTCAGG - Intergenic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104390211 12:128385655-128385677 TTGGAGGAGAACAGGGAGTAAGG + Intronic
1107399271 13:40053220-40053242 TTGGGTCAAAAATAGGAGTAAGG + Intergenic
1107571721 13:41667365-41667387 TTTGAAAATAAAAAGGAGTGAGG - Intronic
1108157650 13:47602994-47603016 TTGGATAACCAGTAGGAGTAGGG - Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1109893047 13:68643811-68643833 TGGGATAATAAAAAGAAGTAGGG + Intergenic
1110099586 13:71580813-71580835 TAGGACATGAAAAAGGAGTTGGG - Intronic
1110515795 13:76411308-76411330 ATGGAAAAGGGAAAGGAGTAGGG + Intergenic
1110777497 13:79425587-79425609 ATGCCTAAAAAAAAGGAGTAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111251810 13:85611209-85611231 TTGGATAGAAGGAAGGAGTAGGG - Intergenic
1111367755 13:87271799-87271821 ATTGATAGGAAAAAGTAGTATGG - Intergenic
1111427371 13:88104523-88104545 GTTGATAAGAAAAAAGAGTATGG - Intergenic
1111750702 13:92328255-92328277 TTGGGTAGGCAAATGGAGTATGG + Intronic
1112659645 13:101492892-101492914 TTGGAAAAGGAAAGGGAGTGAGG - Intronic
1112674148 13:101678862-101678884 TTGGGGAGGAGAAAGGAGTAGGG - Intronic
1113148546 13:107236420-107236442 TGGGATAAAAAATAGGAGCATGG + Intronic
1114768966 14:25407391-25407413 TTGAAAAAGAAAAAGGACTGTGG - Intergenic
1115352503 14:32410290-32410312 TGGGTTAAGATAAAGGGGTATGG - Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117685183 14:58245502-58245524 TTGTATAGGAAAAACGAGAAAGG - Intronic
1117734678 14:58756505-58756527 TTTGGTTAGAAAAAGGAGAATGG - Intergenic
1117872320 14:60213949-60213971 ATGGATTAGAAAAAGGATCAAGG - Intergenic
1118333668 14:64833740-64833762 TGGGATAAGAAGAATGAATATGG - Intronic
1119222126 14:72917472-72917494 ATGGGTAAGATAAAGGAGTTGGG - Intergenic
1120279202 14:82418176-82418198 ATGGAAAACAAAAAAGAGTAGGG - Intergenic
1121102785 14:91261515-91261537 TTGGATAAGGACAGGGAGGAGGG + Intergenic
1122673908 14:103394144-103394166 TTAAAAAAGAAAAAGGAGTCAGG + Intronic
1124168102 15:27347399-27347421 TGGGAAAGGGAAAAGGAGTAAGG - Intronic
1125372729 15:38995725-38995747 ATGGATAAGAGACAGGAGAAGGG - Intergenic
1125691240 15:41598008-41598030 GTGGCTAAGAAAAGGGATTACGG - Intergenic
1126361073 15:47846609-47846631 GGGGAGAAGAAGAAGGAGTAGGG + Intergenic
1126683665 15:51228191-51228213 TTAGAGAAGAAAGAGAAGTAAGG - Intronic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129765040 15:78159297-78159319 TGGGGGAAGAAAAAGGAGGAGGG - Intronic
1130444751 15:83990409-83990431 TTCGATAAGCACAAGGTGTAGGG - Intronic
1132217312 15:100074183-100074205 TTAGAAAAGAAAAATGACTACGG - Intronic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1135712320 16:24728498-24728520 TTAGGTTAGAAAAAGGAGAATGG + Intergenic
1135738386 16:24952392-24952414 TTGAGTATGAAAAAGGGGTAAGG + Intronic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137973461 16:53009259-53009281 TTGGAAACCAAAAGGGAGTAGGG - Intergenic
1139039751 16:62985208-62985230 CTGGCTAAGAAAAATGAGTGAGG - Intergenic
1140921483 16:79542527-79542549 TTGGATAACAAAAGGAAGCAGGG + Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141514549 16:84535055-84535077 TGGGAGAAGGAAGAGGAGTAAGG - Intronic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1143185149 17:5005626-5005648 TTGCAGAAGAGAAAGCAGTAAGG + Intronic
1146786227 17:35724302-35724324 TTGGCCAAGGAAAAGGAGTTTGG - Intronic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1148825467 17:50390239-50390261 TTGGCTGAGGAAAAGGAGTGAGG + Intronic
1149250644 17:54765038-54765060 TTGGAAAAGAAAAAGGAAACAGG + Intergenic
1149749047 17:59127914-59127936 CTGGATAAGAAAATGGAGTATGG + Intronic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1152664614 17:81560115-81560137 TTGGATAAAAACAAAGAGTGAGG + Intronic
1155516921 18:26632836-26632858 TTGGATATGAAAATGGAATATGG + Intronic
1155535138 18:26809159-26809181 TCAGGTAAGAAAAGGGAGTATGG + Intergenic
1155550670 18:26961800-26961822 TTGGATAAGAAACATGGGTGAGG + Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1158288535 18:55912715-55912737 ATGGATCAGAGAAAGGAGAAAGG - Intergenic
1159146854 18:64465764-64465786 GTGGAAAAAAAAGAGGAGTAAGG + Intergenic
1161355175 19:3814995-3815017 CTGGAAAAGTCAAAGGAGTAAGG + Intronic
1162651230 19:12090631-12090653 GTGGGGAAGAAAAAGGAGTCAGG - Intergenic
1164054743 19:21613008-21613030 TTGGATTACATAAATGAGTAGGG - Intergenic
1164929328 19:32163396-32163418 TTGGAAAAGAAATAGTAGCATGG - Intergenic
1165640922 19:37385793-37385815 TTGGAAGAGAGAAGGGAGTAAGG - Intronic
1166226881 19:41401480-41401502 TTGGATTAGAAGGAGGAGTGGGG + Intronic
1166707524 19:44916231-44916253 TTGGATAAGCTGAAGGAGTTTGG + Exonic
1167297313 19:48659104-48659126 TTGGATATGAAGGTGGAGTATGG + Intergenic
925284231 2:2705467-2705489 TTGGATGGGAAAAAGGAGAAGGG + Intergenic
926235186 2:11036463-11036485 TTTGATAACAAAAATCAGTAAGG - Intergenic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
927389597 2:22580391-22580413 TTGTCCAAGAAAAAGGATTAGGG - Intergenic
928780350 2:34810347-34810369 ATGGAGAAAGAAAAGGAGTATGG - Intergenic
928947175 2:36781973-36781995 TTGGATAACAAAAGGGAGAGAGG + Intronic
929717647 2:44329239-44329261 TTGTTTAAGAAAAAGAATTATGG + Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
931080707 2:58766903-58766925 TTAGAAAAGAAAAAGAAGGAGGG - Intergenic
932115775 2:69045571-69045593 TTGGAAAAAGAAAAGGAGGAAGG + Intronic
932724957 2:74171369-74171391 TTTGATAAGTTAAAGGAGGATGG + Intronic
932839283 2:75066683-75066705 TTGGCTAAGAAAAGAAAGTAGGG - Intronic
932940952 2:76164557-76164579 TTGGAAAAAAAAAAGGAAAAAGG - Intergenic
933214882 2:79618609-79618631 TTGGAGAAGAAAAACAAGAATGG - Intronic
933383270 2:81578310-81578332 GTGGATTAGAAAGAGGAGTATGG + Intergenic
933593043 2:84253828-84253850 TTTCATATGAAAAACGAGTATGG + Intergenic
933939072 2:87230573-87230595 TGGGTTAAGATAAAGGATTATGG + Intergenic
934545569 2:95212163-95212185 TAGGGAAAGAAAAAGGAGTCTGG - Intronic
934725544 2:96615612-96615634 TTGGAGAATAAAAAGTACTACGG + Intronic
936354062 2:111735202-111735224 TGGGTTAAGATAAAGGATTATGG - Intergenic
936405650 2:112200270-112200292 TTGGAAATAACAAAGGAGTATGG + Intergenic
936687072 2:114840273-114840295 TTTGAAAGGAAGAAGGAGTAAGG + Intronic
936824371 2:116562780-116562802 TTGCAAAAGAAATAGGTGTATGG - Intergenic
938919387 2:135980835-135980857 TTGGAGAAGAAAAAGGGTAATGG + Intronic
939860049 2:147409194-147409216 TTGGATAGGAAAAGAGAGTCTGG + Intergenic
942694401 2:178623920-178623942 ATGGATAAGAAGATGGAGTGAGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943040150 2:182794864-182794886 ATGGATAAGAAAATGAAGTAAGG + Intergenic
943694456 2:190909640-190909662 TAGGAGAAGAAATAGGAGTTTGG + Intronic
944053368 2:195496693-195496715 TTGGAAAATATATAGGAGTAGGG - Intergenic
944790259 2:203117640-203117662 TTAGATAAGTAAAAGGAAAAAGG + Intronic
944932717 2:204536220-204536242 TTGGAGGAGAAAGAGGGGTAGGG + Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
946207179 2:218118304-218118326 TTTGATAAGAAAAAGTGGTGGGG + Intergenic
946963185 2:225006694-225006716 TTGGAGAAATAAAAGGAGCAAGG + Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
948580197 2:238981894-238981916 TAGGATTAGGAAAAGGAGAAAGG - Intergenic
948769360 2:240240723-240240745 TTTGATAATAAAAAGGAATGCGG - Intergenic
1168981019 20:2003617-2003639 TAGGAGAAGAAAAAGCAGTGAGG - Intergenic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170097243 20:12659658-12659680 ATGGATAAGAAAAACTATTAGGG - Intergenic
1170254638 20:14326696-14326718 TTAGATAAGAAAAAGCATTTGGG + Exonic
1173305908 20:41849241-41849263 TTGATTAAGAAAAAGAAATAAGG - Intergenic
1173423152 20:42920560-42920582 TTGGAAAAAAAAAAGTATTAAGG - Intronic
1174317981 20:49717436-49717458 TTGGAGATGAAAAAGTAGTGTGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174973290 20:55302954-55302976 ATGGAAAACAAAAAAGAGTAGGG - Intergenic
1175547169 20:59785872-59785894 TTGGAAAACAAAATGAAGTAGGG - Intronic
1178028175 21:28492171-28492193 TGGCATAAGAAAAAGGGTTATGG - Intergenic
1178235533 21:30836961-30836983 TTGAAGGAGAAAAAGGAATAAGG + Intergenic
1179539912 21:42077431-42077453 TTGGTTTAGAAAGAGGAGTGGGG + Intronic
1180674574 22:17578410-17578432 TTGGGTAAGAAAAGAGAGGAGGG - Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
949504322 3:4712794-4712816 TTGGATAAGAAAACAGAAAACGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
951673107 3:25206804-25206826 ATGGATGAGAAAAAGTAGTCAGG - Intronic
952134726 3:30404591-30404613 TAGCACAAGAAAAATGAGTAAGG + Intergenic
952546277 3:34422972-34422994 ATGGCTGAGAAAAAGGTGTATGG + Intergenic
952769550 3:36985632-36985654 TGGGAAATGAAAAAAGAGTATGG - Intergenic
952856976 3:37780086-37780108 TTGGGTAAAAAAAAGGAAAAAGG + Intronic
953725664 3:45395733-45395755 GTGGTTATGAAAAATGAGTAAGG + Intronic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
955094209 3:55781522-55781544 TGGGAGAAGAAAAGGGAGCAAGG - Intronic
955831397 3:63008080-63008102 TCAGATAAGAAAATGGAGTTCGG - Intergenic
956192143 3:66618232-66618254 TTGGATTTTAACAAGGAGTAGGG + Intergenic
956879875 3:73499710-73499732 TTAGATTACAAAAAGCAGTAAGG + Intronic
957320869 3:78628504-78628526 TGGGATAAGAGAAAAGAGAAAGG - Intronic
957829484 3:85497306-85497328 ATGGAAAAGAAAAAAGAGTGAGG - Intronic
958068909 3:88583904-88583926 TTGCATAAGAACACAGAGTAGGG + Intergenic
958727568 3:97924397-97924419 ATGAATAAGAAAAAGGTGAAAGG + Intronic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959452590 3:106522266-106522288 TTGGATAAGAAAAATAAAAAGGG - Intergenic
960515514 3:118598317-118598339 TTGGGTAAGAAAAAAGAATTAGG - Intergenic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961424219 3:126832318-126832340 TAGAATAAGAAAAGGCAGTAAGG - Intronic
962288819 3:134112354-134112376 TTAGATAAGAAAAAGAAAAATGG + Intronic
962911321 3:139853680-139853702 ATGGAAAACAAAAAAGAGTAGGG - Intergenic
962933014 3:140054794-140054816 TGGGGTAGGAAAAAGGAGAAGGG + Intronic
963965180 3:151360362-151360384 TTGGGTAAGAAAAAGGATATTGG - Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
964821424 3:160774567-160774589 TTGAATAAGATAAAGGAGCCAGG - Intronic
965308418 3:167097726-167097748 TTGACTTAGAAAAAGGAGCAAGG + Intergenic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966131951 3:176651382-176651404 TTGGTTAAGATAAAGGATTATGG + Intergenic
966333219 3:178839362-178839384 CTAGATAAGAAAGAGGAGAAAGG + Intronic
966679300 3:182624238-182624260 TGGGATAAGGAGAAGGATTACGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968677890 4:1894933-1894955 TGGGGGAAGAAAAAGGAGGATGG - Intronic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970808206 4:20060880-20060902 TTAGATAAGACAGAGGAGGAAGG + Intergenic
970837371 4:20426402-20426424 TTGTATAAGAAAAGGTGGTAGGG + Intronic
971141459 4:23929468-23929490 TTGGAAAAATAAAAGGAGTAAGG + Intergenic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
972523991 4:39890413-39890435 TTTGAAAAGAAAAATGACTAAGG + Intronic
972932252 4:44086781-44086803 CTGCTTAAGAAAAAGGAGTCTGG - Intergenic
973632190 4:52829973-52829995 TGGGAAGAGAAAAAGGAGAAAGG - Intergenic
973894493 4:55397669-55397691 ATGGAAAGGAAAAAGGAGAAAGG - Intronic
973933392 4:55816883-55816905 TTGGATATGGAAATGGAGAAAGG - Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
974757882 4:66235561-66235583 CTGGATTAGAAAAAGCAGCATGG + Intergenic
977070068 4:92374276-92374298 TGGGTTAAGATAAAGGATTATGG - Intronic
977993718 4:103477140-103477162 TTGGATAAGAAAATGAATTTTGG + Intergenic
978853798 4:113370050-113370072 TTTGCTAAGAAAAATGAATACGG + Intronic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
979522439 4:121684540-121684562 GTGGAAAAGAAACAGAAGTAGGG + Intronic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980191454 4:129530019-129530041 TTGGATAAGAAAACAGAGAGAGG - Intergenic
980688705 4:136263044-136263066 ATGGAAAACAAAAATGAGTAGGG + Intergenic
980984989 4:139686268-139686290 TGGGTTAAGATAAAGGATTATGG + Intronic
981398578 4:144284300-144284322 TCAGATGAGAAAAAGGAGTGTGG + Intergenic
982240803 4:153297560-153297582 TTTGAAAAGAAAAGGTAGTAGGG - Intronic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982633248 4:157859514-157859536 ATAGATAATAAAAAGGAATAGGG + Intergenic
983485509 4:168327783-168327805 ATGGAAAAGAAAAAGCAGTTTGG + Intergenic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983547936 4:168982236-168982258 ATGGAAAACAAAAAGGAGCAGGG + Intronic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
984001091 4:174246079-174246101 TTGGATAAGAAGGATTAGTAAGG + Intronic
984583154 4:181533599-181533621 TTGGAGAAGAAAAGAGGGTATGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
988036896 5:25838793-25838815 ATGGATCAGAAATAGAAGTATGG - Intergenic
988178395 5:27757643-27757665 TTGGGTAACAACTAGGAGTAGGG - Intergenic
988219964 5:28331999-28332021 ATGAAGAAGAAAAAAGAGTATGG - Intergenic
988332736 5:29863747-29863769 TTGCAGAAGAAAAAGAAGTTAGG - Intergenic
988864571 5:35321067-35321089 TAGGCTAATAAAAGGGAGTATGG + Intergenic
988951074 5:36261140-36261162 TTGGAAAAGCAAAAGGGGTTGGG - Intronic
990300558 5:54445488-54445510 GTGGTTAAGAACATGGAGTAAGG - Intergenic
990613232 5:57481348-57481370 TAGGCAAAGAAAAAGGAATATGG + Exonic
990648673 5:57873506-57873528 TAGGATAAGTAACAGGAATAGGG - Intergenic
991192215 5:63887901-63887923 CTAGATTAGAAAATGGAGTAAGG + Intergenic
991290748 5:65031697-65031719 TTGGATAGTTAAAGGGAGTAGGG - Intergenic
991428493 5:66517496-66517518 TTGGCTAAGAATCAGGAGCATGG + Intergenic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
992014800 5:72565020-72565042 TTGAAGAAGAAAAAGAAGTCTGG + Intergenic
992648955 5:78838519-78838541 TTGGAAAAAACAAAGAAGTAAGG + Intronic
992751118 5:79862721-79862743 TTGGATCTGCAAAAGGAATAAGG - Intergenic
993253478 5:85557098-85557120 TTGGATAAGAAGAAGCATTCTGG - Intergenic
993359198 5:86952753-86952775 TTTGATCAGAAAAAGAAGCAAGG - Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
993679324 5:90855964-90855986 TTGCATACGTAAAAGGATTATGG - Intronic
993906504 5:93629845-93629867 TTTAACAAGAAAAAGGAGTATGG + Intronic
993909854 5:93667925-93667947 TTGGATGTGAAGGAGGAGTAAGG + Intronic
995025446 5:107415719-107415741 TTGCACAAGAAAGATGAGTAGGG - Intronic
995041766 5:107596014-107596036 TTTGACAAGAAATAGGAGGAAGG - Intronic
995501424 5:112811157-112811179 TTGGATAGGAAAAAGGACAGTGG + Intronic
995743779 5:115382258-115382280 TTGGTTAAGAAAAAAAAATAAGG + Intergenic
996042085 5:118826284-118826306 TTAGATAGGAAAAATTAGTAGGG - Intergenic
996282793 5:121751675-121751697 TTGCAGAAGAAAAAGGAGAGAGG + Intergenic
997059322 5:130481803-130481825 TTTGATAAGAAACAGTAGAAAGG - Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997339171 5:133129240-133129262 TAGGACATGAAAAAGGAGAATGG - Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
998030097 5:138859190-138859212 TTGGAAAACAAATAGGAATATGG - Intronic
998300127 5:141010008-141010030 GTAGATAGGAAAAAGGAGCAGGG - Exonic
998616526 5:143746524-143746546 TTGAATAAGAGAAAGGAATAGGG - Intergenic
999022943 5:148190574-148190596 TAGGATAAGAAAAAGAACTTAGG + Intergenic
999074963 5:148786788-148786810 CTGGAATAGAAAAAGCAGTAGGG + Intergenic
1000670506 5:164056708-164056730 TTGGAGAAGAAAAAGGCTTTTGG + Intergenic
1000773826 5:165391701-165391723 TTAGATAAGATAAAGAGGTAAGG + Intergenic
1002652674 5:180713133-180713155 TGGGTTAAGAAAAAGGGTTATGG - Intergenic
1003652240 6:7971854-7971876 TTGGAAAAGAAAATTGTGTAAGG - Intronic
1004402552 6:15302413-15302435 TTGGGAAAAAAAAAAGAGTAAGG + Intronic
1004739961 6:18450005-18450027 TTGGATAAGAAAAGGGAAATTGG - Intronic
1007938025 6:45751157-45751179 TTGGATAAGAAAAGAGAATTTGG + Intergenic
1009362449 6:62831314-62831336 TTGGCTAAGGAAAAGGAGCTAGG - Intergenic
1009409792 6:63352815-63352837 TTAGATAAGAGTAAGGATTAAGG + Intergenic
1009755627 6:67936397-67936419 TGGGAAAAAATAAAGGAGTATGG - Intergenic
1009957304 6:70471325-70471347 GGGGATAATGAAAAGGAGTAGGG + Intronic
1010104644 6:72152202-72152224 TTGGTTAAGAAAATGAAATATGG - Intronic
1010806620 6:80244756-80244778 TTGGAAAAAGTAAAGGAGTACGG + Intronic
1010819222 6:80394021-80394043 TTCTATAAGTAAATGGAGTAAGG - Intergenic
1011059269 6:83245111-83245133 TTAGATAAGAAAAGGAAGAATGG + Intronic
1011629730 6:89311904-89311926 TTGGCAAAGGAAAAGGAGTTGGG - Intronic
1012538110 6:100324372-100324394 ATGGAAAACAAAAAGGAGCAGGG - Intergenic
1012701983 6:102469812-102469834 TTGGATAAATACAAGGAGTGTGG + Intergenic
1013679908 6:112513651-112513673 TTGGATAGTGAAAAGGAGAATGG + Intergenic
1013752468 6:113423227-113423249 TTAGAGGAGACAAAGGAGTATGG - Intergenic
1014169437 6:118262391-118262413 GTGGAAAAGAAAAAGAGGTAGGG + Intronic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016325264 6:142893622-142893644 TTGATTGAGAGAAAGGAGTATGG - Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1018079747 6:160248448-160248470 TTGGATAAGAAACAGGCTTCTGG + Intronic
1018465745 6:164043153-164043175 TTGGATAAACAAAAAGAATAAGG - Intergenic
1019698513 7:2461019-2461041 TTGTTTAATAAAAAAGAGTAAGG + Intergenic
1020610519 7:10390928-10390950 CAGGATAAGAAAAAGGATTGTGG - Intergenic
1020621908 7:10528685-10528707 TTGGAGAAGAAAAGGGACTCTGG - Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021260838 7:18455105-18455127 TTGGATAATAAAAAGGAGACAGG + Intronic
1021411721 7:20336447-20336469 CTGGACAAGAAAATGGAGTTTGG - Intronic
1021839600 7:24712118-24712140 ATGGAAAAGAAAAAGAAGAATGG + Intronic
1022229840 7:28404174-28404196 ATGGAAAAGAAAAAGAACTATGG + Intronic
1023008621 7:35904258-35904280 TTGGAAAAGAACAAGAAGAAAGG + Exonic
1023016550 7:35973629-35973651 TTGGAAAAGAACAAGAAGAAAGG + Intergenic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1024128436 7:46325150-46325172 TTGGGTAAGAAAGAGAAGTGGGG - Intergenic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1026842751 7:73679603-73679625 GTGAAAAAGAAAAAGGATTAAGG + Intergenic
1027464378 7:78496778-78496800 TTGGTTAAGAACAAGGACCATGG + Intronic
1027662544 7:81004698-81004720 TTGACTTAGAAAAGGGAGTATGG + Intergenic
1027666161 7:81044729-81044751 TTGAATGACAAAAAGGAATATGG - Intergenic
1027978105 7:85184972-85184994 TCGGAGAAGGAAAAGGAGAAGGG + Intronic
1028247964 7:88505181-88505203 TTAGACAAGAGAAAGGAATAAGG - Intergenic
1028349834 7:89832511-89832533 TTGGAGAAGAAAAGGGTGCAAGG - Intergenic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1029480266 7:100808019-100808041 TGGGAAAAGAGAAAGGAGGAAGG - Intronic
1030713505 7:112782424-112782446 TTGGAAAAGAAAAAGTATTTAGG + Intronic
1031473731 7:122197923-122197945 TTGGGTAAGAAAAAGGAAATGGG - Intergenic
1031812796 7:126392859-126392881 GTGGAGAAGAACAAGGAGTTTGG - Intergenic
1032842507 7:135725494-135725516 TTGGGCAAGAAAAAGGGGGAAGG + Intronic
1032965800 7:137095577-137095599 ATGGAAAACAAAAAAGAGTAGGG + Intergenic
1034611006 7:152368626-152368648 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1035435383 7:158855854-158855876 TTTGATAAAAACAAGCAGTAAGG - Intergenic
1035835104 8:2741675-2741697 TTGGTTAAGATAAAGGATTATGG - Intergenic
1035970609 8:4243828-4243850 ATGTATAAGAAAACAGAGTAGGG + Intronic
1036288225 8:7463212-7463234 AAGGATAAGAAAATGGAGTCGGG + Intronic
1036333250 8:7848316-7848338 AAGGATAAGAAAATGGAGTCGGG - Intronic
1036939298 8:13036240-13036262 TTGGATGAGAAAAAAGATTTTGG - Intergenic
1038061517 8:23919033-23919055 ATGCATAGGAAAAAGGAGTAAGG - Intergenic
1038645558 8:29358792-29358814 TTGTCTAAGAGAAAGGAATAAGG - Intergenic
1038985234 8:32801799-32801821 TGGTATCAGAGAAAGGAGTAAGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1040809652 8:51437815-51437837 TTGGACAAGAGAAAGAAATAAGG + Intronic
1042552783 8:70009236-70009258 ATGGTTAAAAAAAAGTAGTAGGG - Intergenic
1042778456 8:72462938-72462960 TGGGGAAAGAAAAAAGAGTAAGG - Intergenic
1043096630 8:75983652-75983674 TTGCAAAAGAAAAAAGAGTTTGG + Intergenic
1043282251 8:78482738-78482760 TTGGATAAGTAAATGAACTAAGG + Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1044716407 8:95103789-95103811 TTGGAGAAGAAGTTGGAGTAGGG + Intronic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1045076912 8:98579925-98579947 TAGGTTAAGAAAAGAGAGTATGG + Intronic
1045812378 8:106237935-106237957 TAAGAGAAGAAAAAGGAGTAGGG + Intergenic
1046100237 8:109605467-109605489 TTGAATGAAAAAAAGGAGCAGGG - Intronic
1046955262 8:120056726-120056748 TTGGATAAGAAAAAGTGGCTGGG - Intergenic
1047620719 8:126603827-126603849 GTTCATGAGAAAAAGGAGTAGGG + Intergenic
1047875295 8:129130110-129130132 TTGGAGAAAAAAAAATAGTATGG + Intergenic
1048863037 8:138737731-138737753 TGGGATCAGAAAAAGGACTCAGG + Intronic
1048966357 8:139617807-139617829 TAGGAAAAGAGAAAGGAGTTAGG + Intronic
1049231245 8:141484296-141484318 TAAGGTAAGAAAAAGGAGAAGGG - Intergenic
1050148400 9:2593981-2594003 TTGGGGAAGAACAAGAAGTAGGG + Intergenic
1050859084 9:10401472-10401494 TTAGATATGAAAATGGTGTATGG + Intronic
1051093489 9:13437688-13437710 TTGCATAAGGAAGAGGAGTCAGG - Intergenic
1051935427 9:22438188-22438210 TTTGATAAGGAAAAGTAGTGGGG - Intergenic
1052835569 9:33247519-33247541 TTAGCTAGGAAAAAGGAGCAAGG + Intronic
1053183023 9:35990617-35990639 TTGGAGAAGAGAGGGGAGTAAGG - Intergenic
1055045985 9:71924230-71924252 TTGGAAAAGAATTAGGACTAAGG - Intronic
1055370516 9:75593476-75593498 TGGGTGAAGCAAAAGGAGTAGGG - Intergenic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1055840871 9:80501644-80501666 TTGGTTAAGAAAATGGAATCAGG + Intergenic
1056154330 9:83818905-83818927 GTAGAAAAGACAAAGGAGTATGG + Intronic
1056201697 9:84283173-84283195 TTAGAAGAGAAAAAGGAGTCTGG + Intronic
1056266118 9:84898021-84898043 TGGGATAAGAAAAAGATGAAAGG + Intronic
1056298387 9:85216917-85216939 TTAGATGAGAAAAATGAGTTAGG - Intergenic
1056356178 9:85804222-85804244 GTAGAAAAGACAAAGGAGTATGG - Intergenic
1057856859 9:98608099-98608121 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1058238601 9:102525871-102525893 TTGGTTAAGAATAAGGACTTTGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1059000217 9:110340902-110340924 TTCCACAAGAAAAAGGAGAATGG - Intergenic
1059623997 9:116041188-116041210 ATGGAAAAGAAAAAGGAGACGGG + Intergenic
1062251172 9:135594990-135595012 TTGGATAAGAGCAATGAGAAAGG - Intergenic
1185617546 X:1432525-1432547 TCGGACAAGAAAAGGGAGAAAGG + Intronic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1188403693 X:29780145-29780167 TTTGATAATAAAAAGGAAGATGG - Intronic
1188940074 X:36226488-36226510 TTGTATAAGAAACATAAGTAGGG - Intergenic
1189457904 X:41210955-41210977 AAGGAAAAGAAAAAGGAGAAAGG - Intronic
1189608557 X:42706185-42706207 TTGGATAAGAGAAAGTAGTAGGG - Intergenic
1190070994 X:47279267-47279289 TTGGAAAAGAAAAAGAAATCCGG + Intergenic
1190712063 X:53078443-53078465 TTGGAGAAGTCAAGGGAGTAGGG + Exonic
1195546412 X:106117062-106117084 TGGGTTAAGAAAAAGGATTGTGG + Intergenic
1195954618 X:110316993-110317015 TTGGATAAAAATAAGTAGTAAGG + Intronic
1196072475 X:111541818-111541840 TTGCAGAAGAGAAAGGAGTGGGG - Intergenic
1196210442 X:112990173-112990195 ATTGATAGGAGAAAGGAGTAAGG - Intergenic
1196567121 X:117221436-117221458 ATGAATAAGAAAAAGGAGAGGGG - Intergenic
1197105481 X:122708798-122708820 TTGGATAAGAGTGATGAGTATGG - Intergenic
1199409740 X:147507334-147507356 TGGTATTAGAAAAATGAGTAAGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1199733898 X:150666436-150666458 TTAGATAAGAAAAAGAAATCGGG - Intronic
1200870705 Y:8095036-8095058 ATGGTTCAGAAAAAAGAGTACGG + Intergenic
1201793985 Y:17874899-17874921 TTAGAAAAAAAAAGGGAGTAGGG - Intergenic
1201807569 Y:18031086-18031108 TTAGAAAAAAAAAGGGAGTAGGG + Intergenic