ID: 1093828982

View in Genome Browser
Species Human (GRCh38)
Location 12:23731726-23731748
Sequence TTGGATTCCTTTGCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093828980_1093828982 -10 Left 1093828980 12:23731713-23731735 CCCACTTGATGTATTGGATTCCT 0: 1
1: 0
2: 0
3: 7
4: 205
Right 1093828982 12:23731726-23731748 TTGGATTCCTTTGCTAAAACTGG 0: 1
1: 0
2: 3
3: 20
4: 239
1093828979_1093828982 -9 Left 1093828979 12:23731712-23731734 CCCCACTTGATGTATTGGATTCC 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1093828982 12:23731726-23731748 TTGGATTCCTTTGCTAAAACTGG 0: 1
1: 0
2: 3
3: 20
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093828982 Original CRISPR TTGGATTCCTTTGCTAAAAC TGG Intronic
902709867 1:18231270-18231292 TTGGATTCTTTGGGTAAATCAGG + Intronic
903012526 1:20341579-20341601 TTGGATACTTTTGCTATAAACGG + Intronic
904640606 1:31924802-31924824 TTGTATTCTTTTGTTAAAAATGG - Intronic
906371522 1:45258072-45258094 TTGAATTCCTTTCCTGAAAATGG - Intronic
908428637 1:64034119-64034141 TTTGATTCCATTGCTGAAAATGG + Intronic
908708653 1:66990665-66990687 ATAGATCCCTTTGCCAAAACTGG - Intergenic
909059433 1:70863138-70863160 ATGGATTTATTTGCTAAAAGAGG + Intronic
909602595 1:77476518-77476540 ATGGATTCATTTGCTAAAAGTGG - Intronic
911210957 1:95137510-95137532 TGTGATTCCTTTGCAAATACAGG - Intronic
911410479 1:97499217-97499239 TTGTATTCCTTTGGTAAATTTGG + Intronic
913965497 1:143373894-143373916 TTGGATTAATTTTCTAAAAAAGG + Intergenic
914059871 1:144199498-144199520 TTGGATTAATTTTCTAAAAAAGG + Intergenic
914119279 1:144766871-144766893 TTGGATTAATTTTCTAAAAAAGG - Intergenic
919407202 1:197200754-197200776 TTGGCTGCCTTTTCTAAACCCGG - Intergenic
919719646 1:200819416-200819438 TTGTATTTATTTGCTAAATCTGG + Intronic
920788612 1:209066766-209066788 GTGGATTCCTTTGGGAACACTGG + Intergenic
922326647 1:224534677-224534699 ATGGAGTCCTTTTCTATAACAGG + Intronic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924653015 1:245948023-245948045 CAGGGTTCTTTTGCTAAAACTGG - Intronic
1062951092 10:1504127-1504149 TTGGATTCCGTTGCTTAAACTGG + Intronic
1064150135 10:12856002-12856024 TTGGATTCCTTTTCTAGCAGTGG + Intergenic
1064428622 10:15252483-15252505 TTAGATGCCTTTAGTAAAACAGG + Intronic
1064798146 10:19037412-19037434 TAGGATTCCTTTTCTAAACAAGG + Intergenic
1067433241 10:46258474-46258496 TTGCATTCCTTATCTGAAACTGG - Intergenic
1067783179 10:49223695-49223717 TTGGATTCCTTCTCTACCACAGG + Intergenic
1068766769 10:60773199-60773221 TTGGATTCCTTTTCTTAAAAGGG + Intergenic
1069063147 10:63914915-63914937 CTGGATTCCTTTGCTAAGGCTGG - Intergenic
1069775746 10:70926152-70926174 TTGCATTTATTTGCTAAATCTGG - Intergenic
1070570077 10:77634454-77634476 TTGGGTTCCTTTGATCAAAAAGG + Intronic
1074294156 10:112167583-112167605 CTGGTTTCCTTTGCTTAAGCAGG - Intronic
1078075998 11:8161369-8161391 TTGATTTCCTTTGCCAAAATAGG - Intronic
1079431814 11:20397241-20397263 ATTGATTCATTTGCTAAAAAAGG + Intronic
1083370275 11:62173436-62173458 TTGGTATCCTCTGCAAAAACAGG - Intergenic
1087798512 11:102479289-102479311 TTGCATTCCTTAGATAAAAAGGG - Intronic
1088203823 11:107369277-107369299 TTATATTTCTTTTCTAAAACTGG + Intronic
1088427994 11:109726211-109726233 TTGGCTTGGTTTGCTAAATCAGG - Intergenic
1089821147 11:121227201-121227223 TTGGATTCTTCTCCTAAAAATGG + Intergenic
1090165619 11:124543745-124543767 TTGGATTCCTTTTCTAAGAATGG - Intergenic
1090367286 11:126217384-126217406 TTGTAATTTTTTGCTAAAACAGG + Intronic
1091036992 11:132243630-132243652 TTTGTTTCCTTTGCTGAAAATGG + Intronic
1092899990 12:13049641-13049663 AAGGATTTCTTTTCTAAAACTGG + Intronic
1093448594 12:19289251-19289273 TTGGATTCCTTAGATAAAACTGG - Intronic
1093828982 12:23731726-23731748 TTGGATTCCTTTGCTAAAACTGG + Intronic
1094707384 12:32927391-32927413 TTGTATTCCATTGCCATAACCGG - Intergenic
1098118615 12:67209587-67209609 TTGGTTTCCTTTTCAATAACTGG - Intergenic
1100246395 12:92762146-92762168 TTGGGTTCCTTTGCTTAGGCAGG - Intronic
1100837200 12:98577637-98577659 TTAGCTCCCTTTGCTAAAACTGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1103869130 12:124078556-124078578 CAGGATTCTTTTGCTAAAACTGG + Intronic
1105161373 13:17438660-17438682 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105162289 13:17453260-17453282 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105162698 13:17459883-17459905 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105163200 13:17467867-17467889 TTTGATGCCTTTGGTGAAACAGG + Intergenic
1105163775 13:17476863-17476885 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105167954 13:17542663-17542685 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105169920 13:17573602-17573624 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105171506 13:17598411-17598433 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105171903 13:17604517-17604539 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105173158 13:17623884-17623906 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105173283 13:17625755-17625777 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105173890 13:17635277-17635299 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105174691 13:17647692-17647714 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105175051 13:17653303-17653325 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105175555 13:17661290-17661312 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105175754 13:17664351-17664373 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105176099 13:17669791-17669813 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105177220 13:17687134-17687156 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105177339 13:17689005-17689027 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105177985 13:17699041-17699063 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105178988 13:17714345-17714367 TTTGATGCCTTTGGTGAAACAGG + Intergenic
1105179631 13:17724209-17724231 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105181102 13:17747311-17747333 TTTGATGCCTTTGGTGAAACAGG + Intergenic
1105182117 13:17763119-17763141 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105182356 13:17766853-17766875 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105182693 13:17772115-17772137 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105183034 13:17777557-17777579 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105183965 13:17792156-17792178 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105184997 13:17808130-17808152 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105185474 13:17815612-17815634 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105185815 13:17820877-17820899 TTGGATGCCTTTGGTGAAAAAGG + Intergenic
1105187339 13:17844842-17844864 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105188063 13:17856071-17856093 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105189733 13:17882077-17882099 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105189849 13:17883949-17883971 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105191986 13:17916936-17916958 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105192108 13:17918803-17918825 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105193640 13:17942432-17942454 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105193872 13:17945999-17946021 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105194344 13:17953298-17953320 TTTGATGCCTTTGGTAAAAAAGG + Intergenic
1105194583 13:17957041-17957063 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105194704 13:17958911-17958933 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105194952 13:17962652-17962674 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105195300 13:17968093-17968115 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105195417 13:17969963-17969985 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105195651 13:17973703-17973725 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105195767 13:17975576-17975598 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105196232 13:17982882-17982904 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105198771 13:18022664-18022686 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105199220 13:18029789-18029811 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105199673 13:18036760-18036782 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105200365 13:18047459-18047481 TTTGATTCCTTTGGTGAAAAAGG + Intergenic
1105531560 13:21225332-21225354 GTGGATTGCTTTGCTAATCCTGG - Intergenic
1108743242 13:53360981-53361003 TTGTATTCCTTTTCTTAAAGAGG - Intergenic
1109036999 13:57276477-57276499 TTGCTTTCCTTTCCTTAAACTGG + Intergenic
1110635874 13:77766466-77766488 TTGGATTCCTTCTCTACCACAGG + Intergenic
1118368133 14:65113092-65113114 TTAGGGTTCTTTGCTAAAACCGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121037231 14:90716367-90716389 ACAGATTCTTTTGCTAAAACTGG + Intronic
1126265869 15:46753311-46753333 ATGGGCTCCATTGCTAAAACAGG - Intergenic
1126664419 15:51063346-51063368 TGGAATTTCATTGCTAAAACTGG + Intronic
1127317076 15:57807424-57807446 TTGAAGTACTTTGCTAAAACTGG + Intergenic
1130925388 15:88381824-88381846 TTGAGTTCTTTTGCTAAAAGTGG - Intergenic
1132180446 15:99749028-99749050 TTGTATGCCTTTGATAAAAATGG + Intergenic
1133970589 16:10565060-10565082 TTCTATTTCTTTGCTAAAACAGG + Intronic
1137728792 16:50674673-50674695 TTGGCTTTACTTGCTAAAACTGG + Intronic
1137855814 16:51793604-51793626 TTGAATTGCTTTGGGAAAACTGG - Intergenic
1138340255 16:56284581-56284603 TGGGTTTCCTTAGCTAAAAGTGG + Intronic
1140958453 16:79889447-79889469 TGGAATTCCTTTGATAGAACAGG - Intergenic
1145685290 17:26651690-26651712 TTTGATGCCTTTGCTGAAAAAGG + Intergenic
1146191830 17:30775055-30775077 CTGGATTCATTTGCTAGATCTGG + Intronic
1147762429 17:42808036-42808058 TTGTTTTCCTTTTATAAAACTGG + Intronic
1149477934 17:56978855-56978877 TTGTTTTCCTTTTCTAAAATGGG + Intronic
1149620719 17:58043073-58043095 CTGCATTCCTTTGCTCAGACAGG + Intergenic
1149702610 17:58667995-58668017 CAGGGTTCCTTTACTAAAACTGG - Intronic
1149853166 17:60053917-60053939 TTGGATTCCTTCTCTAGTACAGG - Intronic
1150997251 17:70332673-70332695 TTGCATTCTTATACTAAAACAGG + Intergenic
1154133507 18:11756186-11756208 TTGGATTCCTTAGATAATATAGG - Intronic
1154947227 18:21174196-21174218 TTGGCTTCATTTGTTAAAAAGGG - Intergenic
1157089622 18:44622113-44622135 TTGGATTGCTTTGCCAAATATGG - Intergenic
1158678652 18:59546655-59546677 TTGGATTTCTTAACTATAACAGG - Intronic
1202699276 1_KI270712v1_random:151380-151402 TTGGATTAATTTTCTAAAAAAGG + Intergenic
927055232 2:19360576-19360598 TTGTCTTTCTTTTCTAAAACAGG + Intergenic
931106428 2:59061573-59061595 TTGGAATACTTTACTAAAACTGG - Intergenic
931550076 2:63434135-63434157 TTTCCTTCCTTTGCTAAAAATGG - Intronic
933722374 2:85406406-85406428 CAGGGTTCTTTTGCTAAAACCGG - Intronic
934170224 2:89534865-89534887 TTGGATTAATTTTCTAAAAAAGG + Intergenic
934280526 2:91609189-91609211 TTGGATTAATTTTCTAAAAAAGG + Intergenic
934322198 2:91980968-91980990 GTGAGTTCCTTTGCTGAAACTGG + Intergenic
937563857 2:123259731-123259753 TTGGGTTCCTTTGCCCATACTGG + Intergenic
937915117 2:127095134-127095156 TTGGATGCATTTGCTGAACCTGG - Intronic
939023455 2:136985147-136985169 TTGGATTCCTTCCCTACCACAGG - Intronic
940467295 2:154047203-154047225 TTGAATACATTTGCTAAAGCTGG + Intronic
941419814 2:165269486-165269508 TTGGCTTCCTTTGGTAAAATGGG + Intronic
941600655 2:167539457-167539479 ATGCATTACTTTGCAAAAACAGG + Intergenic
942072472 2:172328327-172328349 TTGGATTCTTTTGCTTCAAAAGG - Intergenic
943125205 2:183788334-183788356 TTGGATTTCATTGTTAACACTGG + Intergenic
943327552 2:186519837-186519859 TTGGATCCTTTTTCTAAAATAGG + Intergenic
948433460 2:237935783-237935805 GAGGGTTCTTTTGCTAAAACTGG - Intergenic
1169727188 20:8748246-8748268 TTGGATGCCTTGGATAAAACTGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173696481 20:45019604-45019626 ATGAATTCCTATGCTAAGACTGG - Intronic
1173777811 20:45725607-45725629 TTTCTTTCCTTTGCTTAAACAGG + Exonic
1174530145 20:51205412-51205434 TTAGTTTCCTTTTCTAAAATGGG - Intergenic
1174579050 20:51558026-51558048 TTTTGTTCCTTTGCTAGAACAGG - Intronic
1174594480 20:51673015-51673037 TTTTATTCTTTTGCTAATACAGG + Intronic
1174983431 20:55422660-55422682 ATGAATTCCTGTGCTAAAACTGG - Intergenic
1182697591 22:32207043-32207065 GTGAGTGCCTTTGCTAAAACTGG + Intergenic
1183144318 22:35975498-35975520 TTGGATTCCTAATCTAAATCAGG - Intronic
1184637809 22:45849044-45849066 TGGCATTCCTCTGCTAAAAATGG - Intergenic
950950729 3:16995670-16995692 TTGGATTACATTACTAAAATTGG + Intronic
951626289 3:24667423-24667445 TTGGAATGCTTTCATAAAACAGG + Intergenic
954493228 3:50927682-50927704 TTGGTTTCCTTTTCTAAGTCTGG + Intronic
957095942 3:75777601-75777623 TGGGAGTGATTTGCTAAAACCGG + Intronic
957096132 3:75778898-75778920 TGGGAGTGCTGTGCTAAAACCGG + Intronic
957096145 3:75778968-75778990 TGGGAGTGCTGTGCTAAAACCGG + Intronic
958198495 3:90275966-90275988 TTGGATTCCTATGGTGAAAAAGG - Intergenic
961316238 3:126037735-126037757 TTTGATTCCTTTTCTACCACAGG - Intronic
963234425 3:142942975-142942997 TTGCATTCCTTTTCTTAAAGAGG - Intergenic
963562557 3:146884179-146884201 TTGGATTCCTCTGCCAACCCTGG - Intergenic
963881040 3:150528769-150528791 TTGTAATCCTTTGCTAAATATGG + Intergenic
965463120 3:168993482-168993504 CAGGGTTCTTTTGCTAAAACTGG - Intergenic
965681857 3:171260007-171260029 CAGGGTTCTTTTGCTAAAACTGG - Intronic
968838905 4:2986173-2986195 TGTGATGCCTTTGCTAATACTGG + Intronic
969029573 4:4200980-4201002 TTGGATTAATTTTCTAAAAAAGG - Intronic
969891693 4:10265863-10265885 TTAGGGTTCTTTGCTAAAACTGG + Intergenic
970855529 4:20646584-20646606 GTGGAGTTCTTTGCTGAAACTGG - Intergenic
971355355 4:25890330-25890352 TGGGATTTCTTTGCTAACAAGGG + Intronic
972779103 4:42270545-42270567 TTGCATTTCTTTGCTCAACCTGG - Intergenic
975268193 4:72396104-72396126 TTGGTTTCATTTACTAAAACTGG + Intronic
975376785 4:73655277-73655299 TTGGATGCCTTTTCTAAGACTGG - Intergenic
975586540 4:75955688-75955710 TTGCATTCCTTTACTTATACTGG + Intronic
976194885 4:82522943-82522965 TGGGGTTTTTTTGCTAAAACGGG + Intronic
976408333 4:84684521-84684543 TTGGATTCATTTTGTAAAAGTGG - Intronic
979299326 4:119068500-119068522 TAGGATTCCTTAGAAAAAACAGG - Intergenic
979395628 4:120185565-120185587 TAGGAATCCTTTTCTAAAATAGG + Intergenic
980830618 4:138126524-138126546 TTGGATTCTTTTGTTACCACAGG - Intergenic
980892132 4:138827190-138827212 ATGAATTTCTTTCCTAAAACAGG + Intergenic
983251187 4:165348246-165348268 TTGGATTCACTTGCTGAACCAGG - Intergenic
984590860 4:181616261-181616283 TTGGAAACCTTTACTAATACAGG - Intergenic
985877616 5:2612323-2612345 TAGGATTCCTGAGCTACAACCGG + Intergenic
987910908 5:24144071-24144093 TTGTTTTTCTTTGGTAAAACAGG + Intronic
988715678 5:33824941-33824963 TTGGATTCCTGAGCTACCACTGG + Intronic
990397700 5:55400502-55400524 TTGGTTTAATTGGCTAAAACAGG + Intronic
990550486 5:56872215-56872237 TTGCATTTCTTTGCTCACACAGG - Intronic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
991173818 5:63661331-63661353 TTGGATTATTTTGCCAAAAATGG + Intergenic
992609250 5:78493144-78493166 TGGGATTCCTTTGGTAGAAGAGG - Intronic
994406401 5:99351492-99351514 ATGGATTCCTTTAATAAAAGTGG + Intergenic
995037241 5:107548559-107548581 TTGGATTCCTGTTGTACAACGGG + Intronic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
996197413 5:120625905-120625927 TTGGATTCCTTTGCTGTAGAAGG - Intronic
998168758 5:139859787-139859809 TTGGTTTCCTTTCCAAAAAATGG - Intronic
1000970887 5:167713337-167713359 TTGGATTTCTGTGCCAAAGCTGG + Intronic
1001927678 5:175650298-175650320 TTGGATTCCTCTCCTGAAAATGG + Intergenic
1001980527 5:176034798-176034820 GTGAATGCCTTTGCTGAAACTGG - Intergenic
1002236934 5:177809267-177809289 GTGAATGCCTTTGCTGAAACTGG + Intergenic
1003543910 6:7042333-7042355 TTGCATTTCTTTGCGATAACTGG - Intergenic
1005682025 6:28217298-28217320 GTGGCTTCCTTTGCTAAGAATGG - Intergenic
1008327065 6:50195205-50195227 TTGGATGCCTTTTCTTAGACTGG - Intergenic
1009051911 6:58285866-58285888 TTAGAATCCTTTGCTATAACTGG - Intergenic
1011079355 6:83472497-83472519 TTTGTTTCCTTGGCTGAAACAGG + Intergenic
1011388947 6:86829689-86829711 TTGGTATCATTTGCTAAAATGGG - Intergenic
1011417094 6:87133292-87133314 TTAGGGTTCTTTGCTAAAACTGG - Intergenic
1012068933 6:94586915-94586937 TTAGTTTCCATTGCTAAAATGGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013759294 6:113498234-113498256 ATGGATTTCAGTGCTAAAACTGG + Intergenic
1013961130 6:115901709-115901731 TTGGATACCTTCCCTAAAAGAGG + Intergenic
1014698320 6:124651907-124651929 TTGGATTTCTTTCCTAAAAAAGG + Intronic
1014880778 6:126721810-126721832 TTGATTTGCTTTGCTGAAACTGG + Intergenic
1014936164 6:127387524-127387546 TTAGTGTCCTTTGCTAAAAGTGG - Intergenic
1017372409 6:153727900-153727922 CTGTATTCCTTTGCTAAAAGAGG + Intergenic
1017856216 6:158351425-158351447 TTTGATTAATTTGCAAAAACGGG - Intronic
1020630940 7:10638835-10638857 TTGGATCCATTTAATAAAACAGG + Intergenic
1022303373 7:29122502-29122524 CTAGTGTCCTTTGCTAAAACTGG + Intronic
1023120544 7:36904063-36904085 TTGGCTGCCCTTGCTAAAGCAGG - Intronic
1023564116 7:41506687-41506709 TCTGATACTTTTGCTAAAACTGG - Intergenic
1024123057 7:46264492-46264514 TAGAATTCCTTTGTTAAAAATGG - Intergenic
1024323585 7:48091969-48091991 TTGGTTTCCTTTTCTACAAACGG + Intronic
1027671011 7:81099203-81099225 TTGTACTCCTTTGATAAAACAGG - Intergenic
1029910610 7:104143068-104143090 AGGGATTCGTTTGCTAAAATAGG + Intronic
1032536291 7:132667380-132667402 TTGGATTCTTTTGTTAGAAAAGG + Intronic
1033993001 7:147311119-147311141 CAGGGTTCTTTTGCTAAAACTGG + Intronic
1034120923 7:148627091-148627113 TCCTATTCCTTTGCTAATACAGG - Intergenic
1034847642 7:154461891-154461913 TTGGTTGCCTTTGCTAAATAGGG + Intronic
1040435707 8:47389262-47389284 TTGGTTACCTTTGCAAAAATAGG + Intronic
1041185461 8:55295969-55295991 TTGAATTTCTCTGCTACAACAGG - Intronic
1043389120 8:79774463-79774485 TAGGCTTCCTTTTCTAAAACTGG - Intergenic
1044407342 8:91843698-91843720 TTGGATACCTTCAATAAAACTGG - Intergenic
1045612171 8:103858194-103858216 TTGCATACTATTGCTAAAACAGG + Intronic
1046910558 8:119621738-119621760 TTGGGTTCCTTTGGAAAAATGGG + Intronic
1047389423 8:124438110-124438132 TTTGATTCTTTTTCTTAAACAGG - Intergenic
1048062585 8:130935785-130935807 TTTGTTTCCTTTGTGAAAACTGG + Intronic
1048099989 8:131340887-131340909 TTGGATTCCAGTGCTAAAACAGG + Intergenic
1048613366 8:136048318-136048340 TTGGATTCTTATTCTAAAAGAGG - Intergenic
1049530228 8:143150874-143150896 TTGGATTCTTTTAAAAAAACAGG - Intergenic
1051190700 9:14508800-14508822 TAGGACTCCTTTGCTAACAGGGG - Intergenic
1052462318 9:28781518-28781540 ATGGCTTCCTTTTCTAAAGCAGG - Intergenic
1055922626 9:81477475-81477497 TTGACTTCCTATTCTAAAACTGG - Intergenic
1056268024 9:84919089-84919111 TAGGATTCCTCTGCTCAATCAGG - Intronic
1057395851 9:94679365-94679387 TTGGAAAACTTTGCTAAAAATGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057847774 9:98538763-98538785 CTGGATTCCTTTTATGAAACTGG - Intronic
1058333511 9:103795705-103795727 TGGGATTTCTTTGTTAAAAGTGG - Intergenic
1060148952 9:121274866-121274888 CAGGATTCTTTTGCTAAAACTGG + Intronic
1188917275 X:35927263-35927285 TTTGATTCCTATGCAAAAATGGG - Intronic
1189656425 X:43249517-43249539 TTGAATTCCTTTCCTGAAAATGG - Intergenic
1191271327 X:58475283-58475305 TTTGATTCCTATGGTAAAAAAGG + Intergenic
1192159423 X:68772025-68772047 TTAAATTCCTTTACTAAATCTGG - Intergenic
1192442448 X:71184776-71184798 TTGGATTCCTTTGGTGACAGGGG + Intergenic
1195336732 X:103862285-103862307 TTGGCTTCTTTTGCCAAAAAGGG - Intergenic
1196608982 X:117689167-117689189 TTGAATTCTTATGCTGAAACAGG - Intergenic
1201718545 Y:17072970-17072992 GTGGCTTCCTGTGCTAGAACAGG + Intergenic
1202104265 Y:21346090-21346112 TTAGATTCCTTTACTGAAAGCGG + Intergenic