ID: 1093832610

View in Genome Browser
Species Human (GRCh38)
Location 12:23782394-23782416
Sequence ATGCAGAAGCAGAATGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093832610 Original CRISPR ATGCAGAAGCAGAATGACTG TGG Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900790128 1:4674541-4674563 GTGCAGAAGCAGAAATACGGAGG + Intronic
903359074 1:22765726-22765748 ATGCAGAGACGGAAAGACTGAGG - Intronic
904137087 1:28321528-28321550 ATGGAGAAGCAGAAGGGCAGAGG - Intergenic
904702386 1:32365678-32365700 TTCCAGAAGCAGAAGGGCTGAGG + Intronic
904833211 1:33318843-33318865 AGGCAGAGGCATAATGAGTGAGG - Intronic
905441432 1:37998649-37998671 ATGCAGAAGCAGATAAACAGAGG - Intronic
905952479 1:41963748-41963770 ATGAAGAAGCAAAATGTCTTTGG + Intronic
906103439 1:43277559-43277581 ATGCAGGAGCACAAGGACAGGGG + Intergenic
906705166 1:47889281-47889303 ATGCAGAAGCCGAATGTCCTTGG + Intronic
906788009 1:48632999-48633021 ATGCAGAGATAGAATGATTGTGG - Intronic
907525551 1:55052001-55052023 ATGAAGGAGCAGGATGACTTGGG + Intronic
908681794 1:66670102-66670124 CTGCAGTAGGAGAATGACAGGGG - Intronic
909130956 1:71736814-71736836 ATGCAGAAGGAGAAAAAATGTGG + Intronic
909610162 1:77543020-77543042 CTGCAGCAGCAGAATTGCTGAGG - Intronic
909858292 1:80570229-80570251 ATGCCAAACCAGAATGAGTGTGG + Intergenic
910840184 1:91553932-91553954 ATTTACATGCAGAATGACTGTGG + Intergenic
911426993 1:97729272-97729294 ATGCACAAGCAATATGACTGGGG + Intronic
912421498 1:109545180-109545202 AGGAAGAATTAGAATGACTGGGG + Exonic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
915734799 1:158077968-158077990 CTGCAGAAACAGAAAGAATGAGG - Intronic
917488575 1:175477861-175477883 AGTCAGAAGCTGAAGGACTGCGG - Intronic
917758849 1:178133171-178133193 ATGCAGTAGAAGGATGACAGAGG - Intronic
918447819 1:184632380-184632402 ATGCATAAGAAGAATCACTGAGG + Intergenic
918881775 1:190133442-190133464 ATGCAGCAGCATATTTACTGTGG + Intronic
919677384 1:200397106-200397128 TTGTTGAAGCAGAATGACTGTGG - Intergenic
920104707 1:203543874-203543896 AAACAGAAGCATAATGACAGAGG - Intergenic
920287191 1:204888929-204888951 ATTCAGAAGCAGAAAGCATGAGG - Intronic
921668746 1:217903425-217903447 ATGCAGAAATAGAACGATTGAGG + Intergenic
922796790 1:228343484-228343506 ATGCAGACGCAGAGTGCGTGTGG + Intronic
923941204 1:238829444-238829466 ATGCAGAAATAGTATGACAGTGG - Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924780298 1:247141354-247141376 ATGCAGAACCATAGTTACTGGGG + Intronic
1065480642 10:26190384-26190406 ATGGAGAAGAATGATGACTGCGG + Intronic
1065602415 10:27383105-27383127 ATACAGAAGTAGACTGACTTTGG - Intergenic
1065800477 10:29347022-29347044 ATGCGGAGGCAGAATTTCTGGGG + Intergenic
1070827386 10:79399158-79399180 ATGGAGGAGAAGAAGGACTGTGG + Intronic
1071031160 10:81183098-81183120 ATGAACAAGTAGAGTGACTGTGG + Intergenic
1074274749 10:111990583-111990605 GTGAAGAAGCAGTATCACTGTGG + Intergenic
1075665286 10:124225430-124225452 ATGCAGAAGCACTGTGCCTGGGG + Intergenic
1076353514 10:129834860-129834882 ATTCAGAAGCAGAGGGGCTGGGG + Intergenic
1080938753 11:36890386-36890408 ATGCTATTGCAGAATGACTGAGG + Intergenic
1081589416 11:44410783-44410805 AGGCAGAAGCAGAATAAGAGAGG + Intergenic
1083540129 11:63506619-63506641 TGGGAGAAGCAGAAAGACTGAGG - Intronic
1085239890 11:75044492-75044514 ATGCACAGCCAGTATGACTGTGG - Intergenic
1085267523 11:75246040-75246062 CTGCAGAAGCCAAATGACAGAGG + Intergenic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1086059007 11:82681453-82681475 ATGCAGGGGCAGATGGACTGAGG - Intergenic
1086093074 11:83023407-83023429 ATGCACAAGCACAAAGCCTGAGG + Intronic
1086852346 11:91824436-91824458 ATCCAGAAGCAGCAGGACTGAGG + Intergenic
1086939114 11:92777306-92777328 ATGTAGATACAGAATCACTGAGG - Intronic
1087066099 11:94029417-94029439 TTGCAAAAGCAGAATCACTGTGG + Intronic
1089129605 11:116201298-116201320 ATGGAGAAGCAGGATTGCTGCGG + Intergenic
1091189078 11:133674790-133674812 AAGCAGAAGCCAAATTACTGAGG - Intergenic
1091192798 11:133708355-133708377 ATGCAGAAACAGAAGCACAGAGG - Intergenic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1093003849 12:14031110-14031132 AAGCAGAAGGAGAATGACATAGG - Intergenic
1093529409 12:20143135-20143157 AGGCAGAATGAGAATGAATGTGG + Intergenic
1093823408 12:23650710-23650732 ATGCAGAAACGGAATGAATGGGG + Intronic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1094248046 12:28325732-28325754 TTGCTGAAGCAGAATGAATGAGG + Intronic
1095285844 12:40409448-40409470 AGACAGAAGGAGCATGACTGTGG - Intronic
1095629231 12:44354939-44354961 ATGCAGAACCATAATCACTGGGG + Intronic
1098211275 12:68168545-68168567 ATGCAGAAACAGAATGTCACCGG + Intergenic
1098212450 12:68180882-68180904 ATGCAGGAGGAGAAAGAATGAGG - Intergenic
1099010079 12:77281399-77281421 ATCTAGAAGCAGAAAGAATGTGG + Intergenic
1099189362 12:79546889-79546911 ATAGAGAATCAGAAAGACTGTGG + Intergenic
1101615442 12:106331890-106331912 ATGAAGAAGCAGCTTGACTGGGG - Intronic
1103140505 12:118543898-118543920 TTACAGATGCAGATTGACTGAGG - Intergenic
1103274765 12:119702015-119702037 AGGCAGAAGCAGAACAGCTGTGG - Intronic
1104270549 12:127278939-127278961 ATGCAGGAGCAGAGAGAATGAGG - Intergenic
1105241138 13:18610335-18610357 ATGCAGAGGCAGGAGGACAGAGG - Intergenic
1107465397 13:40645396-40645418 ATCCACAAGGAGAATGACTTAGG - Intronic
1107812135 13:44210578-44210600 TTGAAGAAGCAGATTGGCTGTGG + Intergenic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1111827083 13:93281076-93281098 ATGCTGAAGCTGAATGACTTTGG - Intronic
1112154622 13:96803918-96803940 CTGCAGAACCAGACAGACTGTGG + Intronic
1112445893 13:99463770-99463792 AGGCAGAAGCAGATTGCCTTAGG - Intergenic
1112802575 13:103128925-103128947 ATGCAGAATCATAATGACTTTGG + Intergenic
1113374021 13:109747015-109747037 ATGCTAAAGCTGAATGACGGTGG + Intergenic
1113795559 13:113055792-113055814 CTGCAGAAGGTGAATGGCTGTGG + Intronic
1113825029 13:113245959-113245981 ATGCAGAATCAGAGTGACTCAGG + Exonic
1114152861 14:20064322-20064344 CTGCACAAGCAGAATAACTCTGG - Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114969280 14:28005511-28005533 GGGCAGTAGCAGGATGACTGGGG + Intergenic
1115701396 14:35956657-35956679 TTGCCGAAGCAAAGTGACTGCGG - Intergenic
1116268273 14:42725687-42725709 AAGCAAAAGTAGAATGCCTGGGG + Intergenic
1117608688 14:57460290-57460312 TTCCAAAAGCAGAATTACTGGGG + Intergenic
1118757405 14:68854773-68854795 CTGCAGAAGCAGCATTACAGGGG + Intergenic
1118766688 14:68914662-68914684 AGGCAGAGGCAGGAGGACTGGGG + Intronic
1118821567 14:69349408-69349430 TTGCAGGGGCAGAATGAATGGGG - Intronic
1121780575 14:96619361-96619383 ATGGAGATGCAGAAAGACAGTGG + Intergenic
1123178982 14:106449775-106449797 ATGTAGACGCAGCATGGCTGAGG + Intergenic
1123490216 15:20774812-20774834 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1123546717 15:21343899-21343921 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1126232276 15:46341282-46341304 ATACAGAAGCAGATTTATTGGGG + Intergenic
1126250120 15:46557504-46557526 AGGCAGATGTAGAATCACTGGGG - Intergenic
1127839716 15:62820522-62820544 TTGCAGAAACAGAGTTACTGGGG + Exonic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1130773359 15:86947711-86947733 GTGTAGCAGCTGAATGACTGAGG + Intronic
1131853065 15:96563436-96563458 ATGCAGGAGCAGCAGGAATGGGG - Intergenic
1202955048 15_KI270727v1_random:71114-71136 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1136344714 16:29667195-29667217 CTGCAGCTGCAGAATGACAGAGG + Exonic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137043508 16:35636539-35636561 GGTCAGCAGCAGAATGACTGGGG + Intergenic
1137462463 16:48677881-48677903 ATGCAGAAGCAGGAGCCCTGAGG - Intergenic
1137738861 16:50745294-50745316 AGGCAGAAGCTGAGTGAATGTGG + Intronic
1137859728 16:51834235-51834257 AGGCAGAAGAAGAACGGCTGGGG - Intergenic
1138221448 16:55255136-55255158 ACACAGGGGCAGAATGACTGAGG + Intergenic
1139605304 16:68013994-68014016 AGGCATAGGCAGAATGACTCAGG + Intronic
1139868127 16:70080089-70080111 ATGTACAAGGAGAATTACTGGGG - Intergenic
1140387208 16:74551764-74551786 ATGTACAAGGAGAATTACTGGGG + Intronic
1140525257 16:75617705-75617727 ATGCTGAATCAGAATCTCTGTGG + Intronic
1141669065 16:85482024-85482046 ATCCAAAGGCCGAATGACTGAGG - Intergenic
1141817093 16:86418766-86418788 AAGCACATGCAGTATGACTGAGG - Intergenic
1141850807 16:86644628-86644650 TTGCAGATGGAGAATCACTGAGG - Intergenic
1142821287 17:2469755-2469777 AGGCCGAAGCAGATTGTCTGAGG - Intronic
1143720645 17:8806699-8806721 AAGCAGAAACAGAAGAACTGGGG - Intronic
1145740476 17:27270093-27270115 ATGCAGAAGGAGCAAGACTGAGG - Intergenic
1149076177 17:52597871-52597893 ATGCACAGCCAGTATGACTGTGG - Intergenic
1150434221 17:65141470-65141492 ATGCAGAAGCAGAAATATTGAGG + Intronic
1150445077 17:65222455-65222477 ATGTAGAATCACAGTGACTGTGG - Intronic
1151417944 17:73978945-73978967 TGGCAGAAGCAGAAAGACAGAGG - Intergenic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1155558936 18:27053774-27053796 AAGCAGAAACAGCATGAATGGGG - Intronic
1156380991 18:36560999-36561021 ATACATAAACAGAATGTCTGCGG - Intronic
1156889915 18:42178880-42178902 GTTCAGAAGCAGAATAATTGAGG + Intergenic
1157343161 18:46798480-46798502 ATGAAGAAGAACAATGTCTGAGG + Intergenic
1158662566 18:59401917-59401939 TTCCAGCAGCAGAATGGCTGGGG - Intergenic
1159485088 18:69045468-69045490 ATGCAAAAACAGAAATACTGAGG + Intronic
1161237646 19:3205761-3205783 ATGTAGATGCAGATTCACTGGGG - Intronic
1162633167 19:11944890-11944912 ATGCACAGCCAGTATGACTGTGG + Intronic
1164134021 19:22394824-22394846 TTACAGCAGCAGAAAGACTGTGG + Intronic
1164164786 19:22661942-22661964 TTACAGCAGCAGAAAGACTGTGG - Intronic
1164644476 19:29848195-29848217 AAGAAAAATCAGAATGACTGAGG + Intergenic
1165578015 19:36838299-36838321 ACACAGAAGCCGAATGACTCCGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166557936 19:43713816-43713838 CTGCTGCAGCAGAATGAATGAGG + Intergenic
1167860880 19:52282888-52282910 ATTCAGAAGCAGACAGTCTGTGG + Intronic
1168719299 19:58546033-58546055 CTCCAGAAGCAGAAAAACTGGGG + Intronic
925595312 2:5550025-5550047 CTGCAGAAGCAGAATCTCCGTGG - Intergenic
929827636 2:45321777-45321799 AGACAGAAGCAGCAGGACTGAGG + Intergenic
929830738 2:45344413-45344435 CTGCAGCAGCAGCATGCCTGGGG - Intergenic
929887826 2:45894222-45894244 ACTCAGTAGCAGAATCACTGGGG + Intronic
930353900 2:50293068-50293090 ATGTAGAATCAGAAAGACTTGGG - Intronic
932569135 2:72928754-72928776 ATGCACAGGAAGAATGACTAGGG + Intronic
933781528 2:85805518-85805540 TTGCAGATGCTGAATGAGTGGGG + Intergenic
933940532 2:87241183-87241205 ATGCAAAGGAAGGATGACTGAGG + Intergenic
934061497 2:88298295-88298317 AAGAAGAAGAAGAATGCCTGCGG - Intergenic
935097554 2:99960404-99960426 ATGAAGTATCAGAATGACTACGG - Intronic
935933807 2:108159019-108159041 ATTCAGAAGGAGACTGACAGAGG + Intergenic
936352604 2:111724593-111724615 ATGCAAAGGAAGGATGACTGAGG - Intergenic
938656527 2:133440376-133440398 ATTCAACAACAGAATGACTGTGG - Intronic
939322110 2:140637530-140637552 ATACAGAAGCAGAATGCTTTGGG - Intronic
939571787 2:143848475-143848497 ATGCAGAGAGAGAATGACAGAGG - Intergenic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
940484685 2:154282544-154282566 ATGCAGAAGAAGAGGGAATGAGG - Intronic
942718059 2:178917234-178917256 ATTCAAAAACAGAATTACTGAGG + Intronic
943463039 2:188193448-188193470 ATGCAGAAGCAGGAGGATAGAGG - Intergenic
944302696 2:198142656-198142678 ATTCAGAAGCCAAATCACTGTGG + Intronic
946644272 2:221816410-221816432 CTGTACAAGCAGCATGACTGGGG - Intergenic
947370435 2:229440267-229440289 ATGAAGATGGAGAATGGCTGTGG + Intronic
947826471 2:233108889-233108911 ATGCAGAAGCTGCAAGACTGTGG - Intronic
948167214 2:235872461-235872483 ATGCAGAATCAAAAAGACTTAGG + Intronic
948846416 2:240684792-240684814 ATGCAGATGCAGGGAGACTGTGG - Intergenic
948847446 2:240689941-240689963 ATGCAGATGCAGGGAGACTGTGG + Intergenic
1169543884 20:6630922-6630944 ATGCAGATGCAGAATGTCATGGG + Intergenic
1169736876 20:8847183-8847205 CTTCAGAATCAGAATGTCTGAGG - Intronic
1170037230 20:12002447-12002469 TTGCAGAATCAGAATCTCTGGGG + Intergenic
1172087714 20:32400764-32400786 ATGCAGAAGCAGAAGCCCTATGG - Intronic
1172444691 20:34986880-34986902 AGACAGAAGCAGCATGTCTGGGG - Exonic
1172877704 20:38175894-38175916 GCTCAGAGGCAGAATGACTGAGG + Intergenic
1174661290 20:52215339-52215361 AGGCAGAAGCAGAGGGGCTGGGG + Intergenic
1176448387 21:6841099-6841121 ATGCAGAGGCAGGAGGACAGAGG - Intergenic
1176826557 21:13706121-13706143 ATGCAGAGGCAGGAGGACAGAGG - Intergenic
1178098321 21:29239085-29239107 TTGCAGATGCAAAATCACTGTGG + Intronic
1178771733 21:35511095-35511117 ATTCAGAAGCAGCATTCCTGGGG - Intronic
1184495596 22:44839384-44839406 ATGCAGAAGCCTTATGGCTGTGG + Intronic
951095120 3:18620332-18620354 ATGCAGAAGGAAAATTACTTGGG + Intergenic
953451043 3:43006553-43006575 ATCAAGAATCAGAATGGCTGTGG - Intronic
953735462 3:45490439-45490461 AAGTAGAAGGAGAATGGCTGGGG + Intronic
953784996 3:45904744-45904766 TTGATGAAGCAGAAAGACTGTGG - Intronic
954425131 3:50439209-50439231 AGGCAGAGGCTGAAAGACTGAGG + Intronic
955521567 3:59780334-59780356 ATGAAGAAGTAGAATGTCAGTGG + Intronic
955920122 3:63946707-63946729 AGGCAGAATCACATTGACTGAGG + Intronic
956373441 3:68588782-68588804 TGGCAGAAGCAGAGTGAATGAGG + Intergenic
956734723 3:72229435-72229457 ATGCAGCAGAAGAATTACTAGGG - Intergenic
957283711 3:78187833-78187855 TTGCAGAAGAAAAATGACTTAGG - Intergenic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
958174509 3:89979061-89979083 ATGAAGCAGCAGCATGACTTGGG + Intergenic
959412310 3:106039533-106039555 GTGAAAAAGAAGAATGACTGAGG - Intergenic
961953731 3:130778189-130778211 ATGAAGAAGCAGAATTTCTGGGG - Intergenic
962137692 3:132754542-132754564 AAGCACAAACAGAATGACAGTGG + Intergenic
964444778 3:156747576-156747598 AGACAGAAGCAGAATGTCCGAGG + Intergenic
964682988 3:159362857-159362879 AGGCAAAAGCAGAATTACTGGGG - Intronic
964874949 3:161356791-161356813 ATGCAGAAGCAGGTCAACTGAGG - Intronic
964941878 3:162167952-162167974 ATGCAGAAGAAAAATGAAAGGGG - Intergenic
965048088 3:163605033-163605055 ATGCAGAAGCTGCTTGTCTGTGG + Intergenic
966264299 3:178019890-178019912 TTTCAGATGCAGAACGACTGAGG - Intergenic
966795813 3:183712537-183712559 AGCCAGAGGCAGAATTACTGAGG - Intronic
970238425 4:13982218-13982240 AGGAAGAAACAGAATGTCTGTGG - Intergenic
971533957 4:27724486-27724508 ATGCAGAAAGGCAATGACTGTGG + Intergenic
972424201 4:38917387-38917409 ATGCAGAAGCTGTATGATTTTGG + Intronic
972991120 4:44823424-44823446 ATGCACAGTCAGTATGACTGTGG + Intergenic
973303946 4:48622441-48622463 CTGCCAAAGCAGAATCACTGAGG - Intronic
973575854 4:52288645-52288667 ATACAGAATCAGAATCTCTGAGG - Intergenic
975936617 4:79589085-79589107 ATGCAATAGCAGTATGATTGTGG + Intergenic
976075259 4:81290884-81290906 CTTCAGAGGCAGAATGATTGGGG - Intergenic
976780125 4:88749594-88749616 ATGCTGATACATAATGACTGGGG + Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
977555787 4:98486331-98486353 AGGCAAAAGCACAGTGACTGTGG - Intronic
977759246 4:100711641-100711663 AGTCAGCATCAGAATGACTGAGG + Intronic
978262131 4:106772922-106772944 ATGCAGAAGCTGAAACAGTGTGG + Intergenic
980765959 4:137304721-137304743 CTGTACAAGCAGCATGACTGGGG + Intergenic
982190509 4:152850115-152850137 ATGCTGATGCAGAATGACAGGGG - Intronic
982905640 4:161066750-161066772 ATACAGGAGCAGAAAGAATGAGG + Intergenic
983585062 4:169345581-169345603 ATTCAGAAGAACAATGACTCTGG - Intergenic
983853525 4:172613049-172613071 ATGTGGAAGCTGAATGAATGTGG - Intronic
984304980 4:177977462-177977484 ATGAAGCAGCACAATCACTGGGG - Intronic
984765422 4:183397141-183397163 ATCTAGAAACAGAATGAGTGAGG + Intergenic
985386754 4:189455207-189455229 ATGCTGAGACAGATTGACTGGGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987851849 5:23364707-23364729 ATCCAGAAGCAATATGATTGTGG + Intergenic
990705088 5:58519273-58519295 ATTCAGTAGGATAATGACTGTGG - Intergenic
990816650 5:59793171-59793193 ACTCAGAGGCAGAATGACTCAGG + Intronic
991982766 5:72250412-72250434 CTGGAGAAGCAGCATTACTGTGG - Intronic
992123816 5:73621442-73621464 AGGCAGAAGCGGGAGGACTGAGG + Intergenic
992202917 5:74401656-74401678 AGGCAGAGGCAGGAGGACTGAGG - Intergenic
992970704 5:82054341-82054363 ATGCAGAATCAGGAGGTCTGGGG + Intronic
993799609 5:92316587-92316609 ATGAGGAAGCAGAAAGACAGAGG + Intergenic
996273198 5:121633678-121633700 ATGATCAAGAAGAATGACTGAGG - Intergenic
997360621 5:133292374-133292396 ATGTAGAGGCAGGAGGACTGGGG - Intronic
997383925 5:133457758-133457780 TGGCAGAAGCAGATTGAATGGGG - Intronic
997775953 5:136605357-136605379 ATGCAGAAGTAAAATGGCTTTGG - Intergenic
998781118 5:145657886-145657908 ATGCAGAAAGATAGTGACTGTGG - Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
999720689 5:154397227-154397249 ATCCAAAACCAGCATGACTGAGG + Intronic
1001430191 5:171654756-171654778 TTAGAGAAGCAGCATGACTGTGG + Intergenic
1001781022 5:174369240-174369262 ATTCAGAAGCAAAAACACTGAGG - Intergenic
1002206186 5:177564112-177564134 ATGCAGAAGTAGCAGGCCTGTGG + Intergenic
1004903923 6:20218935-20218957 AGGCTGGAGCAGAGTGACTGAGG + Intergenic
1005228467 6:23671412-23671434 AGGCTGAAGTTGAATGACTGTGG + Intergenic
1006445992 6:34080051-34080073 AGGCAGGGGCAGAATGAGTGAGG - Intronic
1007982539 6:46173508-46173530 GTGCAGAAGCAGAATCCCAGTGG - Intergenic
1010348923 6:74848291-74848313 ATGCAGAAACAGAAATATTGTGG + Intergenic
1010687759 6:78872056-78872078 ATGTAGAACTAGAATGACTGAGG + Intronic
1011616812 6:89204849-89204871 ATACAGATGCAGAATGGCAGAGG - Intronic
1013182926 6:107733129-107733151 ATTCAGAACCAGAAGGCCTGTGG + Intronic
1014068910 6:117158884-117158906 ATCTAGAAGTGGAATGACTGGGG - Intergenic
1014917787 6:127173736-127173758 AAGCAGATGCAGCATGACTTTGG + Intronic
1016292994 6:142544052-142544074 ATGCAGAGGGATAAGGACTGTGG - Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1017724425 6:157267299-157267321 ATGCAGAAGCCGCATGGGTGTGG - Intergenic
1018171299 6:161145259-161145281 CTGCAGAGACAGAATCACTGGGG + Intronic
1019307806 7:344169-344191 CTGCAGAAGCCGAGTGGCTGGGG + Intergenic
1022218778 7:28291484-28291506 TAGCAGAAGCAGATTGACAGAGG - Intergenic
1022488794 7:30800801-30800823 ATGCAAAGGCAGAAACACTGAGG - Intronic
1023119037 7:36890887-36890909 GTGCTGGAGCAGAATAACTGAGG - Intronic
1023171550 7:37394523-37394545 CTGCAGAAGGAGAATAATTGGGG + Intronic
1023851627 7:44153378-44153400 ATGCAGAAGGAGATGGACCGCGG - Exonic
1024719800 7:52122649-52122671 ATGCAGAAGCACATTATCTGAGG + Intergenic
1025969785 7:66311542-66311564 ATGCATCAGAAGAAAGACTGAGG - Intronic
1027858148 7:83539301-83539323 AAGCAGAAGCTGACTGACTCGGG - Intronic
1028623304 7:92847903-92847925 ATGGAGAAGGGGAAAGACTGGGG - Intergenic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1031609067 7:123803789-123803811 ATGCAGAAGAAGAAAGACAAAGG - Intergenic
1031863771 7:127014139-127014161 ATGGAAAGGCAGAATGCCTGGGG + Intronic
1032583934 7:133129367-133129389 ATGCACAAACAGAGTGCCTGTGG + Intergenic
1032725885 7:134589863-134589885 ATCCAGCAGCAGGACGACTGAGG + Intergenic
1033732440 7:144193191-144193213 ATGTGGATGCAGAATGTCTGTGG - Intronic
1033750610 7:144357824-144357846 ATGTGGATGCAGAATGTCTGTGG + Intronic
1033781851 7:144680310-144680332 ATCCAGAAGCAGAGTGACACGGG + Intronic
1035407229 7:158607100-158607122 ACGTAGAAGGAGACTGACTGAGG + Intergenic
1035876173 8:3191873-3191895 ATGAAGAAACACAAGGACTGAGG - Intronic
1038900995 8:31843705-31843727 GGGAAGAAGCAGAGTGACTGGGG - Intronic
1038970635 8:32630070-32630092 ATGAAGAGTCAGAAAGACTGAGG - Intronic
1042085983 8:65109203-65109225 CTGCAGTAGCACAATGTCTGGGG - Intergenic
1042599678 8:70486623-70486645 ATGTAGTAGAAGAATGCCTGCGG + Intergenic
1042699631 8:71598183-71598205 ACCCAGAAGGGGAATGACTGTGG + Intergenic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1043924968 8:86026470-86026492 GTGCAGAAGGAGAGTGAGTGGGG - Intronic
1045949742 8:107838229-107838251 ATGCAGAGGCAGAAAGATAGGGG + Intergenic
1046367879 8:113260023-113260045 ATGCAGCAGAAGAAAGAATGAGG - Intronic
1047569618 8:126083751-126083773 ATGCAGGTGCAGAAATACTGAGG - Intergenic
1048444919 8:134486124-134486146 ATGAAAAACCAGAATGACAGTGG + Intronic
1048651605 8:136484504-136484526 TGGCTGGAGCAGAATGACTGAGG - Intergenic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1051580546 9:18669046-18669068 ATGCAGAACAAGGATGACTGTGG - Intronic
1052198664 9:25749615-25749637 ATTCAGAAGCATACTGAATGAGG + Intergenic
1052595420 9:30551681-30551703 ATGCAAAAGTAGAATGACACTGG - Intergenic
1053096840 9:35335937-35335959 AGGCTGAAGTAGAAGGACTGAGG - Intronic
1054529856 9:66170749-66170771 TCTCAGAAGCTGAATGACTGTGG - Intergenic
1056309337 9:85323260-85323282 AGGCAGAAGCCCACTGACTGTGG + Intergenic
1056620784 9:88212181-88212203 ATACAGATCCAGAATGCCTGGGG + Intergenic
1058002989 9:99885494-99885516 ATGTAGCAGCATAATGACAGTGG + Intergenic
1058398143 9:104579950-104579972 ATGCTGATTCAGAATCACTGTGG + Intergenic
1058398302 9:104582001-104582023 TTACAGAAGGAGAATGACTTTGG - Intergenic
1059976434 9:119722822-119722844 AGGCAGAAGCAGAACGAGAGAGG - Intergenic
1060883938 9:127137414-127137436 ATGGAGAGGCTGAGTGACTGGGG + Intronic
1061337841 9:129953724-129953746 ATGGAGAAGAAGAAAGACTGAGG + Intronic
1203520804 Un_GL000213v1:43419-43441 ATGCAGAGGCAGGAGGACAGAGG + Intergenic
1186380505 X:9053807-9053829 ATCTACAAGCAGAATAACTGGGG + Intronic
1186422413 X:9436801-9436823 AATCAGAAGCTCAATGACTGGGG + Intergenic
1186550981 X:10505379-10505401 ATGAAGAAGCAGAATGGAAGGGG + Intronic
1187259058 X:17668457-17668479 ATGCAGGAACAGAAGGAGTGAGG - Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187736360 X:22308145-22308167 ATGAGGAAGCAGACTGACTTGGG + Intergenic
1187881807 X:23854199-23854221 GTGCAGAAGCAGCTGGACTGTGG - Intronic
1189356567 X:40314099-40314121 GGGCAGAAGCAGGAAGACTGAGG + Intergenic
1189892441 X:45618193-45618215 ATTTACAAGCAGCATGACTGAGG - Intergenic
1189944751 X:46166747-46166769 ATTCAGAGGTAGAATGAATGTGG - Intergenic
1190314715 X:49143138-49143160 ATGCACAGCCAGTATGACTGCGG + Intergenic
1190314954 X:49144712-49144734 ATGCACAGCCAGTATGACTGCGG - Intergenic
1192617745 X:72645593-72645615 ATGCAGAGGAAGAATGATAGGGG + Intronic
1192679886 X:73241628-73241650 GGGGAGAAGAAGAATGACTGGGG + Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1195402061 X:104471664-104471686 ATGCAGAAGGAGCACCACTGAGG - Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196263390 X:113612842-113612864 AAGCAGAAGGAAAATGACAGAGG - Intergenic
1196940235 X:120768434-120768456 AGGCTGAAGCAGAGTGAATGAGG + Intergenic
1198157475 X:133975601-133975623 ATGCCAAGGCAGCATGACTGTGG - Intronic
1198228406 X:134667823-134667845 AGGCTGAAGCAGAAGGACTCTGG + Intronic
1198368146 X:135964205-135964227 ATGCAGAAGAAAAATCATTGAGG - Exonic
1198968133 X:142249800-142249822 AGGCAGAAGCACCATCACTGAGG + Intergenic
1199287827 X:146073607-146073629 ATGCACTAGCAGAAGGACTTGGG + Intergenic
1199937735 X:152592330-152592352 CTACAGAAGCAGAATTGCTGGGG + Intergenic
1199979352 X:152912371-152912393 TTGCACATGCAGAATGACAGAGG - Intergenic
1202037360 Y:20648345-20648367 ATGCACAGCCAGTATGACTGCGG - Intergenic