ID: 1093833547

View in Genome Browser
Species Human (GRCh38)
Location 12:23797315-23797337
Sequence GGATATACACAGATGTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093833546_1093833547 -5 Left 1093833546 12:23797297-23797319 CCTGCTTTAAATGTATGAGGATA 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG 0: 1
1: 0
2: 1
3: 11
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093833547 Original CRISPR GGATATACACAGATGTATCT TGG Intronic
907018723 1:51043794-51043816 AAATATACACAGAAGTATTTTGG + Intergenic
907772350 1:57478135-57478157 GGTTGTACAAAGATTTATCTGGG + Intronic
908912615 1:69089593-69089615 GGACATATACAGATGGACCTAGG - Intergenic
910027515 1:82674659-82674681 GGAAAATCAGAGATGTATCTAGG + Intergenic
911595002 1:99789546-99789568 GCATACACACACACGTATCTTGG + Intergenic
912461916 1:109840084-109840106 ATATATAAACATATGTATCTAGG + Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
916964636 1:169924312-169924334 TAATACACACAGATGTCTCTGGG - Intronic
919381478 1:196866850-196866872 AGAAATACAAAAATGTATCTAGG + Intronic
920665677 1:207961088-207961110 GAATATATACAGGTCTATCTGGG + Intergenic
921984521 1:221297899-221297921 GGATATAAGCAGAAGTATCAGGG - Intergenic
924083034 1:240419626-240419648 GGAAATACTCAGATGTCTCGAGG - Intronic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063257583 10:4345257-4345279 AAATATACACACACGTATCTGGG - Intergenic
1063856372 10:10258863-10258885 ATATATACACACATATATCTAGG + Intergenic
1066627376 10:37420693-37420715 GTATATACACATATATATTTAGG - Intergenic
1067969814 10:50956948-50956970 GGAAATGCACTGATGTATTTAGG + Intergenic
1068297963 10:55099852-55099874 GGATATACACAAATCCATTTAGG + Intronic
1071106124 10:82097399-82097421 AGATATATATATATGTATCTGGG - Intronic
1071636732 10:87263538-87263560 TTATTTACATAGATGTATCTTGG + Intergenic
1071658517 10:87474416-87474438 TTATTTACATAGATGTATCTTGG - Intergenic
1071665317 10:87549954-87549976 GAATATACTCAGATGTATAAAGG + Intronic
1071852417 10:89587288-89587310 GGATAAACACAGCTGACTCTTGG - Intronic
1072290940 10:93963761-93963783 GGATACACACCCATGTAGCTGGG - Intergenic
1074370926 10:112900206-112900228 GGATATGTAAAGATGTAGCTTGG + Intergenic
1076999409 11:315204-315226 GGGTATAAACTGCTGTATCTAGG - Exonic
1081043853 11:38247387-38247409 GCATACACACATATGTATATGGG + Intergenic
1081506490 11:43722358-43722380 GGAAGTATACAGATGTATATTGG + Intronic
1085541329 11:77273056-77273078 GGATATACCTAGATATATTTAGG - Intronic
1085982371 11:81740020-81740042 ACATACACACAGATGTCTCTGGG + Intergenic
1087980745 11:104610623-104610645 GGATATAGACAAATATATTTGGG + Intergenic
1092125832 12:6074443-6074465 GGAGATAACCTGATGTATCTTGG - Intronic
1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG + Intronic
1093611517 12:21165378-21165400 GCATGTACACAGAGGTATTTAGG + Intronic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1094344905 12:29456924-29456946 GGATGAACACAAATGTATTTAGG + Intronic
1096746792 12:53734014-53734036 GGATAGACACAGAGATATTTAGG + Intergenic
1096945117 12:55397313-55397335 ATATATACACATATGTATATAGG + Intergenic
1097396101 12:59076577-59076599 GGATAAAAATAGGTGTATCTGGG + Intergenic
1097716143 12:62968594-62968616 GAATATTCACAGTTGTATGTCGG + Intergenic
1098680172 12:73344287-73344309 GGATATACAAAATTTTATCTAGG - Intergenic
1099768851 12:87026465-87026487 GCAGAAACATAGATGTATCTGGG + Intergenic
1100416525 12:94383212-94383234 GGATATACAAAGCTATATCATGG - Intronic
1101674522 12:106905850-106905872 GTTTATACAAAGATGTGTCTTGG + Intergenic
1101781455 12:107842172-107842194 TGATGTACAAAGATGTATTTTGG - Intergenic
1104153574 12:126108622-126108644 AGATATACACTGATGTAATTGGG + Intergenic
1107594314 13:41946834-41946856 GGAAGTACACAGGTGTGTCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1110110129 13:71734870-71734892 GGATATACGTATATGTATATGGG - Intronic
1110110131 13:71734891-71734913 GGATATACATATATGTATATGGG - Intronic
1110544403 13:76740014-76740036 AGATATACACAGATATATCTTGG - Intergenic
1110749748 13:79098853-79098875 GGAAATACACAGAGGGAACTAGG - Intergenic
1112647491 13:101351004-101351026 GTATATACATATATGTATGTTGG - Intronic
1115047751 14:29017983-29018005 ATATATACACACATGTATATAGG - Intergenic
1115790046 14:36868319-36868341 CAATATATACAGATGTCTCTGGG + Intronic
1116210620 14:41937597-41937619 GGATAGACATAGATATATTTTGG - Intergenic
1117192510 14:53306722-53306744 GGAAATACGCTGATGTATCCTGG - Intergenic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1121161519 14:91745767-91745789 TGATATAAGCAGATGTATATGGG + Intronic
1122472239 14:101977460-101977482 GGAAATACACACAAGTATTTAGG - Intronic
1125321745 15:38496295-38496317 GGATAAACATACATGTATCATGG - Intronic
1129000268 15:72327426-72327448 GAATAGACACACATGTACCTGGG - Intronic
1131232863 15:90672124-90672146 GGATTTCAACAGATGAATCTGGG - Intergenic
1131437286 15:92433346-92433368 GGATGCACACAGATATATGTGGG - Intronic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1133735651 16:8613320-8613342 GGAAATAAACAGAAGTTTCTGGG + Intergenic
1134819071 16:17230828-17230850 AGATATTGATAGATGTATCTAGG - Intronic
1135493700 16:22932954-22932976 GAATATTCAAAGATATATCTGGG - Intergenic
1137019013 16:35404678-35404700 GAAAATATACAGATATATCTTGG - Intergenic
1138212855 16:55177693-55177715 GGATAGAGAGAGATATATCTGGG + Intergenic
1138941213 16:61792973-61792995 GGATATCAACATATGTATTTTGG - Intronic
1140074773 16:71688199-71688221 AGATATACACAGAAGTTTCCTGG - Intronic
1140234979 16:73150756-73150778 GGAGATACAAAGATGTATACAGG - Intergenic
1140283027 16:73572926-73572948 AGATATACAAAGATGAATATAGG - Intergenic
1141032935 16:80605288-80605310 GTATAAACACATATGTATATAGG + Intronic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1143930615 17:10419579-10419601 GGATATAAACTGATAAATCTGGG - Intronic
1148678501 17:49459111-49459133 GGAGATACTCAGATGGATTTGGG + Intronic
1149644526 17:58230311-58230333 GGAGTTACACTGATGTGTCTGGG + Intronic
1153503680 18:5773372-5773394 GGATATAAACAGATGAATGAAGG - Intergenic
1156957585 18:42987188-42987210 GTATACACACACATGTATCATGG + Intronic
1157852992 18:51075052-51075074 GGAAATACATATATGTATATTGG + Intronic
1159153048 18:64545556-64545578 GGATATATACATATATATATGGG + Intergenic
1159706177 18:71691648-71691670 GGATATACCCAGGTCTATCATGG - Intergenic
1160119410 18:76114570-76114592 AAATATACACTGATGTATTTAGG - Intergenic
1163741878 19:19019595-19019617 AAATATACAAAAATGTATCTAGG + Intronic
1164499525 19:28804560-28804582 GTATGTACACACATGTATATAGG - Intergenic
1164499536 19:28805605-28805627 ATATATACACATATGTATATAGG + Intergenic
1164780642 19:30888988-30889010 GGATAAACACAGATATAGATAGG + Intergenic
926989500 2:18662421-18662443 GAATATACACACATGAATCATGG - Intergenic
927227483 2:20783629-20783651 GGATATACAGAGATATACCATGG - Intronic
928788383 2:34918947-34918969 GGGTGTACACACATGTATCCTGG - Intergenic
929326805 2:40623335-40623357 GTATACACATAGATGAATCTTGG + Intergenic
930393139 2:50786647-50786669 AGACACACACAGATGTGTCTCGG - Intronic
930824792 2:55685711-55685733 AAATATACACAGTTGTCTCTTGG + Intronic
932070949 2:68619685-68619707 TGAGTTACACAGTTGTATCTCGG - Intronic
932813618 2:74844377-74844399 GGATTTACTTAGCTGTATCTAGG + Intronic
933495841 2:83049352-83049374 GGATGTACACAGGTCCATCTAGG - Intergenic
936723583 2:115284713-115284735 GGTTATACACCTATGTATCTAGG + Intronic
940114091 2:150188752-150188774 GGGTATACACAGATTTATTTGGG + Intergenic
941055494 2:160783361-160783383 GTCTATACACTGAAGTATCTTGG + Intergenic
941670703 2:168289358-168289380 TGATATTCACTGATGTAGCTGGG - Intergenic
941874235 2:170417264-170417286 GGATAGAGATAGATGTATGTTGG - Intronic
944535833 2:200708675-200708697 GGTTGTATCCAGATGTATCTGGG - Intergenic
945676557 2:212861885-212861907 GTATATGCACAGGTGTATATGGG - Intergenic
946637275 2:221743485-221743507 GGATCTTCACAGATGTAATTAGG + Intergenic
947617387 2:231567129-231567151 GCATTTTCCCAGATGTATCTGGG + Intergenic
1168995548 20:2130152-2130174 GGAGATACACAAATGAGTCTTGG + Intronic
1171002781 20:21431434-21431456 ATATATTCACAAATGTATCTTGG - Intergenic
1171449887 20:25227970-25227992 GGATATGAACAGATGTTTCACGG - Intergenic
1172399987 20:34641637-34641659 GTCTACACACAGATGCATCTGGG - Intronic
1176044858 20:63087325-63087347 GGGTGTACACAGATGCGTCTGGG + Intergenic
1176701764 21:10061554-10061576 GTATATACATATATGTATATAGG - Intergenic
1178078790 21:29040009-29040031 GGATATAAAAAAATGTATTTGGG + Intronic
1178238149 21:30867863-30867885 GGAAAGATACAGATGTCTCTAGG - Intergenic
1180080404 21:45484660-45484682 ACATACACACACATGTATCTAGG + Intronic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182649659 22:31840958-31840980 GGATAAACACAGAAATAACTGGG + Intronic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
949569259 3:5276091-5276113 GGATATAGACATATCTTTCTAGG + Intergenic
950041330 3:9921151-9921173 GGAAATAGAAAGATGAATCTTGG + Intronic
951590256 3:24256678-24256700 GGATGGACACAGATGTAGGTAGG + Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
957214645 3:77303830-77303852 GGATAAGCAGAAATGTATCTGGG + Intronic
957563190 3:81851723-81851745 GTATATACACACATATATGTAGG + Intergenic
957928636 3:86848086-86848108 GGCAATATACAGATGTATGTAGG - Intergenic
959669305 3:108956683-108956705 GGATATGCAAAGGCGTATCTTGG + Intergenic
959820097 3:110723487-110723509 AGATATACATATATATATCTGGG + Intergenic
960184889 3:114626175-114626197 AGAGATGCACAGATGTATATGGG + Intronic
961342351 3:126236223-126236245 GGATATACATATATAGATCTTGG - Intergenic
962391189 3:134974152-134974174 GGATTTAGGAAGATGTATCTGGG - Intronic
963529237 3:146452904-146452926 GGATATATACACATGTGTGTGGG - Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
967320919 3:188194299-188194321 GGTGATACACAGAAATATCTGGG - Intronic
967858005 3:194132942-194132964 GGATGTAGACAGATGCCTCTGGG + Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
971176862 4:24290382-24290404 GGATATTCACTGATGAAGCTGGG - Intergenic
971692301 4:29852469-29852491 GGATATACACACATATATAAGGG + Intergenic
973127328 4:46603756-46603778 GTATATACATATATGTATTTGGG + Intergenic
976393539 4:84531309-84531331 AAATATACACTGAAGTATCTAGG + Intergenic
981437539 4:144743613-144743635 ATATATACACACATGTATTTTGG - Exonic
981700215 4:147599830-147599852 AGATAGACACAGAGGTGTCTGGG - Intergenic
981789069 4:148515698-148515720 AGATATAGATAGATGTCTCTAGG - Intergenic
982137713 4:152287840-152287862 GCATACACACATATGTATGTGGG + Intergenic
982694902 4:158588628-158588650 GGATCCACTCACATGTATCTTGG - Intronic
983859280 4:172685187-172685209 GAATATACATACATGAATCTCGG - Intronic
984629837 4:182049802-182049824 GGCTATACACAAATATCTCTTGG + Intergenic
985318802 4:188686261-188686283 GGCTATACAAAGAATTATCTGGG - Intergenic
986965479 5:13265891-13265913 GTATATATACACATGTATATAGG - Intergenic
992695811 5:79285791-79285813 GTACATTCACAGATTTATCTTGG + Intronic
994665278 5:102697303-102697325 GGTAAAACACAGGTGTATCTGGG - Intergenic
998983545 5:147730284-147730306 GGACATACACAGATGGACTTAGG - Intronic
999980281 5:156951493-156951515 GCAGGTACGCAGATGTATCTTGG - Exonic
1000907953 5:166986255-166986277 GGACATACACAGACTTATTTTGG + Intergenic
1000994988 5:167949772-167949794 GGATATATACAGAGGAATGTGGG - Intronic
1003104686 6:3206320-3206342 GGATTTAAACATATGTATTTCGG - Intergenic
1005345747 6:24888489-24888511 GGATTTCCAAAGATGTAGCTTGG - Intronic
1006453355 6:34118099-34118121 GGAAATACACACATGTATCAAGG + Intronic
1008281007 6:49596078-49596100 GGATATATATATATATATCTTGG + Intergenic
1008281024 6:49596379-49596401 GGATATATATATATATATCTAGG + Intergenic
1008683265 6:53896985-53897007 GTATTTCCACAGATGTAACTTGG + Intronic
1012787106 6:103644897-103644919 GGATTTAAACAGATTTCTCTAGG + Intergenic
1012928966 6:105297064-105297086 GCATGTACACAGGTGTGTCTGGG - Intronic
1014355977 6:120410739-120410761 TTATATACACAGATGTATGTAGG + Intergenic
1014838397 6:126186247-126186269 TGATAAAGTCAGATGTATCTTGG + Intergenic
1015334157 6:132017181-132017203 GGATATATACAAATGTAGCCAGG - Intergenic
1016336696 6:143013245-143013267 GGATGTAAACAGATTTACCTTGG - Intergenic
1016414522 6:143819116-143819138 ACATATACACAGGGGTATCTAGG - Intronic
1017967990 6:159283397-159283419 GTATATACATATATGTATATAGG - Intergenic
1017967991 6:159283423-159283445 GTATATACATATATGTATATAGG - Intergenic
1017967992 6:159283449-159283471 GTATATACATATATGTATATAGG - Intergenic
1017967995 6:159283527-159283549 GTATATACATATATGTATATAGG - Intergenic
1018857033 6:167682120-167682142 GGATATCCTCAGAAATATCTGGG + Intergenic
1018886511 6:167941749-167941771 GGATAGACACAGAGGGATGTAGG + Intronic
1020417371 7:7961339-7961361 GAATATACAAATATGAATCTTGG + Intronic
1021075388 7:16297919-16297941 GGATATACAGAGATATAGATAGG - Intronic
1021285330 7:18774384-18774406 GGATACACACAGACATACCTTGG + Intronic
1024186539 7:46953883-46953905 GCATATAGACAGATATAGCTTGG + Intergenic
1027606197 7:80301929-80301951 GTATATACAACGATGTATCACGG - Intergenic
1028239519 7:88402599-88402621 GTATATACATACATGTATGTAGG + Intergenic
1030229821 7:107196117-107196139 GAATATACTCAGATGTATCCAGG + Exonic
1031284631 7:119850063-119850085 TGATACACACAGATGTATTCAGG + Intergenic
1032012882 7:128358421-128358443 GGATGTAGACAGATGTATCAGGG - Intronic
1032705956 7:134421597-134421619 GGATACACACAGGACTATCTGGG + Intergenic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033900430 7:146132212-146132234 GGTTATACACAGATGTCTGTTGG + Intronic
1036192863 8:6687050-6687072 ATATATACACATATATATCTGGG - Intergenic
1036426336 8:8648292-8648314 GGATAAACACTGATATATTTTGG - Intergenic
1037282244 8:17255070-17255092 GGAAATACAGAGATGAATATGGG - Intronic
1037503567 8:19507929-19507951 TGATATAGAAAGATGCATCTAGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039335583 8:36585720-36585742 GGATATACCTGGATTTATCTAGG + Intergenic
1041639349 8:60179849-60179871 GGCTAAACACAGAAGTATGTAGG + Intergenic
1044869324 8:96603019-96603041 GAATATATACAGATGTACCCAGG - Intronic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1052369003 9:27643611-27643633 ATATATACACATATGTATATGGG - Intergenic
1053377485 9:37619940-37619962 GGATAGAAACAAATGAATCTGGG - Intronic
1055261841 9:74446238-74446260 AAATACACACAGATGTATTTAGG + Intergenic
1057727486 9:97578502-97578524 AGATACACACAGATGTGTCTGGG - Intronic
1058452934 9:105113963-105113985 GCATCTACACAGCTGAATCTTGG + Intergenic
1058672619 9:107373111-107373133 GGAAAGAAACAGATGTATGTTGG + Intergenic
1059243002 9:112824349-112824371 GAATATACACATATATATGTTGG - Intronic
1059309609 9:113378985-113379007 GAATCTACACAGATGGGTCTTGG + Intergenic
1059800246 9:117742877-117742899 TAATATAAAAAGATGTATCTGGG + Intergenic
1059913543 9:119073941-119073963 AGAAATACACAGATGTAGATAGG + Intergenic
1060013534 9:120065880-120065902 GGAAGTACACAGATGTGCCTTGG + Intergenic
1185579841 X:1203414-1203436 GGATGTGGACAGATGTTTCTGGG - Intronic
1185698933 X:2215800-2215822 GGATATAGACAGATCTTTGTGGG - Intergenic
1185699082 X:2216786-2216808 GGATATAGACAGATCTTTGTGGG - Intergenic
1185813584 X:3132861-3132883 GGATATGGACAGATCTTTCTGGG + Intergenic
1185847767 X:3455253-3455275 GGATATATACAGTTGTCTCTAGG + Intergenic
1185994669 X:4932333-4932355 GGGAATACACAGATCTCTCTGGG - Intergenic
1186162281 X:6790127-6790149 AGATATATACAGATGTAGATAGG + Intergenic
1187230404 X:17416111-17416133 GGACATACACTGATAAATCTGGG + Intronic
1188285785 X:28324181-28324203 CTATATACACAGAGGTAACTAGG + Intergenic
1188967342 X:36570759-36570781 GTATTAACACAGATGTCTCTAGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189119583 X:38380056-38380078 GGATACAAACTGATGTATTTTGG - Intronic
1190008936 X:46766495-46766517 GGATATATACATATATACCTAGG - Intergenic
1190247767 X:48701858-48701880 GGCTATATATAGAGGTATCTGGG - Intronic
1192067943 X:67905835-67905857 GGATATAAACAATTTTATCTGGG - Intergenic
1193184424 X:78495531-78495553 GCATATACACAGCTGTACTTAGG - Intergenic
1195444640 X:104938163-104938185 GGATATAAACATATTTATTTTGG + Intronic
1198077415 X:133207165-133207187 AGAGATACACACAGGTATCTGGG - Intergenic
1198524441 X:137486453-137486475 GTAGATACACAGATTTATTTCGG - Intergenic
1198591325 X:138186143-138186165 AGATATATACAGAAGTATTTTGG + Intergenic
1199059387 X:143336497-143336519 GGTAAAACACAGATGTATTTGGG + Intergenic
1199845576 X:151690577-151690599 GGAGAGACACAGATGTAGGTAGG - Intergenic
1200816092 Y:7534194-7534216 GGATACATACAGTTGTCTCTAGG - Intergenic
1200886053 Y:8271102-8271124 AGAAATACAGAAATGTATCTAGG + Intergenic
1201268027 Y:12227679-12227701 GGATATGGACAGATCTTTCTGGG - Intergenic