ID: 1093837080

View in Genome Browser
Species Human (GRCh38)
Location 12:23845685-23845707
Sequence GACAAGCAGGTGACTATTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093837077_1093837080 26 Left 1093837077 12:23845636-23845658 CCTCAAGGGAAAAAAAAATGGAG 0: 1
1: 0
2: 11
3: 132
4: 1072
Right 1093837080 12:23845685-23845707 GACAAGCAGGTGACTATTCCCGG 0: 1
1: 0
2: 1
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093837080 Original CRISPR GACAAGCAGGTGACTATTCC CGG Intronic
900940712 1:5796813-5796835 TTCAAGCATCTGACTATTCCTGG + Intergenic
901202175 1:7473107-7473129 GACAAGCAGCTGACCACTCTGGG - Intronic
904215541 1:28915463-28915485 GACCAGCAGGCCATTATTCCTGG + Intronic
905138924 1:35825316-35825338 GATATGGAGGTGACTCTTCCAGG + Exonic
909637410 1:77832497-77832519 GAAAAGCATGTGATTATTCATGG + Intronic
917221005 1:172728215-172728237 GACCAGCAGGTGACACTTGCTGG - Intergenic
917498930 1:175568162-175568184 GACAGGCAGGTGCCCATTCAAGG + Intronic
918498018 1:185161042-185161064 GAAAAGCAAATGACTTTTCCTGG - Intronic
1067131243 10:43567379-43567401 GAGAAGCAAGTGACCATTACTGG + Intronic
1068341097 10:55704187-55704209 AAGAAACAGGTCACTATTCCTGG + Intergenic
1071782186 10:88858630-88858652 CAGAAGCAGGTGACTATTTCTGG - Intergenic
1076347897 10:129793219-129793241 GACAGGCAGGGGACTGTGCCCGG - Intergenic
1080542950 11:33286501-33286523 GCCAAGCAGTTGTGTATTCCAGG + Exonic
1080901927 11:36502531-36502553 GACAAGCAGGAGAATATGACTGG - Intronic
1081723219 11:45305057-45305079 GACAAGCAGGTGGCCATGCCAGG + Intergenic
1082835527 11:57647962-57647984 GACAGGCAGGTGCTTATTCTGGG - Exonic
1084725460 11:70938966-70938988 GAGAAGCTGGTGGCTAATCCAGG + Intronic
1089325550 11:117654466-117654488 GAGAAGTAAGTGACTTTTCCAGG - Intronic
1089606478 11:119644372-119644394 GAGAAGCAGGTGAAGATTGCTGG - Intronic
1091928010 12:4371053-4371075 GACAAGGTGGTGCCTACTCCAGG - Intronic
1093837080 12:23845685-23845707 GACAAGCAGGTGACTATTCCCGG + Intronic
1094096868 12:26715485-26715507 GAGAAGCAGGTGTCTCTTTCTGG + Intronic
1094416353 12:30220144-30220166 GAGAAACAGGTGCCTACTCCAGG - Intergenic
1095989973 12:48027775-48027797 GACAAGCTGGTGTCCCTTCCAGG - Intergenic
1097141751 12:56908349-56908371 CACCAGCAGGTGACTCATCCTGG - Intergenic
1099016172 12:77346857-77346879 GTCACCAAGGTGACTATTCCAGG + Intergenic
1099792723 12:87357545-87357567 TACAAACACGTAACTATTCCTGG - Intergenic
1100457954 12:94770638-94770660 GCCAAGCAGGTGCCTACTTCAGG + Intergenic
1106954947 13:34926697-34926719 GCCAAGAAGGTTACTATCCCTGG - Intergenic
1109698222 13:65990158-65990180 TACATGCAGTTTACTATTCCTGG - Intergenic
1113304999 13:109068047-109068069 GAAACGAAGGTGATTATTCCAGG + Intronic
1121782599 14:96631541-96631563 GACAAGCAGCTGACTGTTCTTGG - Intergenic
1121845663 14:97169965-97169987 GACAAGGAGGTCACTGTTCCTGG - Intergenic
1123097623 14:105773909-105773931 GACAAGCAGGTGGCAGCTCCTGG - Intergenic
1128411175 15:67399484-67399506 GTCAAGTAGGTGTGTATTCCAGG + Intronic
1128808392 15:70551941-70551963 GAAAAGAAGGTGAGTATTTCAGG + Intergenic
1133324895 16:4936612-4936634 CTCATCCAGGTGACTATTCCCGG + Intronic
1136013299 16:27378816-27378838 GACAAGCAGTTCCCTCTTCCTGG + Intergenic
1138468998 16:57216931-57216953 GACAAGCCGGTCACTAATACTGG - Exonic
1142263559 16:89053494-89053516 GAGACGCAGGTGACAACTCCCGG + Intergenic
1146879229 17:36433472-36433494 TACAACCCGGTGAGTATTCCCGG - Exonic
1147086277 17:38062553-38062575 TACAACCCGGTGAGTATTCCCGG - Exonic
1147094988 17:38133987-38134009 TACAACCCGGTGAGTATTCCCGG + Intergenic
1147102223 17:38186518-38186540 TACAACCCGGTGAGTATTCCCGG - Intergenic
1150582432 17:66486710-66486732 GACAAGCAGGTGGAGATTCAAGG - Intronic
1151336988 17:73445874-73445896 GAGAAGCAGGTGACTAGGCAGGG + Intronic
1154991621 18:21602569-21602591 GACAGGCAGCTCACTATTCGTGG - Intergenic
1156310421 18:35917441-35917463 GACAGGCAGGTGGCTAATCCTGG - Intergenic
1157544914 18:48540329-48540351 GACGAGCAGGTAACTGTCCCGGG + Intronic
1161882622 19:6967304-6967326 GATAAGCAGGTGAGAATTCCTGG - Intergenic
1164593625 19:29519691-29519713 GACAAGCAGCTGCCTATGCAAGG - Intergenic
1166942859 19:46377161-46377183 GACAGGCAGGTGACTCTTACAGG + Intronic
1167765601 19:51480177-51480199 GACAAGCTGGGGACTCTACCAGG + Intronic
928912455 2:36436258-36436280 GACAAGCTGATGACTAGTTCGGG + Intronic
928982954 2:37155404-37155426 GAAAAGCAGGTGACAAGTCCTGG - Intronic
937219878 2:120336634-120336656 CTCAAGCAGGTGCCTATGCCCGG - Intergenic
948396629 2:237649620-237649642 GAGAAGAAGGTGACTTTTCCCGG + Intronic
1170162275 20:13325543-13325565 GACAACTAGGTAACTGTTCCAGG - Intergenic
1174530066 20:51204555-51204577 GACAAGCAGCTAATTTTTCCAGG - Intergenic
1174607651 20:51772611-51772633 AACCATGAGGTGACTATTCCTGG - Intergenic
1181544116 22:23591354-23591376 GACAAGGAGGGCACTCTTCCAGG + Intergenic
1183138380 22:35912605-35912627 TACAATCAGGTGACTTTTACTGG - Intronic
1185385156 22:50528540-50528562 GATAAGCTGGAGTCTATTCCTGG - Exonic
951387705 3:22062667-22062689 GAAAAGCAGGTCACTAAGCCTGG - Intronic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
960237030 3:115295387-115295409 GACAAGCAGCTGACAAGTCTTGG + Intergenic
961183347 3:124893629-124893651 GACAAGCAGGTGACAAGTCCAGG + Intronic
961813051 3:129532764-129532786 AACAAGCAGGTGCCTACTGCGGG + Exonic
962975333 3:140441316-140441338 GACAAGGAAAGGACTATTCCTGG - Intronic
967193356 3:187004488-187004510 TACAAGCAGGAGATTCTTCCTGG - Intronic
969278098 4:6150526-6150548 AAGAAGCGGGTGTCTATTCCTGG - Intronic
970227945 4:13879310-13879332 GCCAAGCACGTGTCTCTTCCTGG - Intergenic
971101958 4:23476734-23476756 GACACACAGGTGACTAAACCAGG - Intergenic
976555108 4:86441771-86441793 GACAAGCATCTGTCTACTCCAGG + Intronic
979993649 4:127405445-127405467 AACAATCTGGTGACTATTGCAGG - Intergenic
985822288 5:2168570-2168592 GACAAGCTTGTGAATATTCTTGG + Intergenic
986049753 5:4077812-4077834 GACATTCAGGTGAATATTCGAGG - Intergenic
989467036 5:41768947-41768969 TACAAGCAACTCACTATTCCTGG - Intronic
990667423 5:58089134-58089156 GAGAAGCAGGAAACTCTTCCAGG + Intergenic
995004086 5:107170144-107170166 GAGATGCTGCTGACTATTCCTGG + Intergenic
995176677 5:109186136-109186158 GACAAGTAGGTGACCCTTCCTGG - Intronic
995230010 5:109749776-109749798 GACAAGCAGGGGAATATTAGTGG - Intronic
995335734 5:110997508-110997530 GAAAAGAAGGTGACTATTTCAGG - Intergenic
996263408 5:121503268-121503290 GACAAGCATCTGACTACCCCAGG + Intergenic
1000674050 5:164098898-164098920 GACAAGCATATCACAATTCCTGG - Intergenic
1018175132 6:161171978-161172000 GACAAGAAGGTAAATATTTCAGG - Intronic
1018864729 6:167737629-167737651 GTCAAGCAGGTGCCCAGTCCGGG + Intergenic
1023358622 7:39393379-39393401 GAAAAGCAGCTGAACATTCCAGG - Intronic
1023586704 7:41738360-41738382 GATCAGCAGGTGAATATTCTAGG - Intergenic
1023937546 7:44750045-44750067 AACAAGCAGGTGACAGTTGCCGG + Intronic
1025524773 7:61791316-61791338 GACAAGAAAGTGAATATCCCAGG - Intergenic
1025588914 7:62830159-62830181 GACAAGAAAGTGAATATCCCAGG + Intergenic
1032426823 7:131829462-131829484 GAGAAGCAGGTGAAACTTCCGGG + Intergenic
1036577451 8:10041201-10041223 CACAAAGATGTGACTATTCCTGG + Intergenic
1038368866 8:26967563-26967585 GTCAGGCAGGTGACAAATCCTGG - Intergenic
1045248450 8:100463441-100463463 GAGAAGCAGGTGACTAACCAGGG + Intergenic
1046439586 8:114240688-114240710 GAAGAGCAGTTGACTTTTCCTGG + Intergenic
1047419472 8:124694733-124694755 GACCAGCACGTGGCTATTACAGG - Intronic
1056506262 9:87261053-87261075 GAAAAGGAGGTGACTATATCAGG - Intergenic
1056531930 9:87496054-87496076 TACAGGCATGTGACTATGCCCGG - Intergenic
1057198425 9:93127734-93127756 TCCAAGCAGGTGACCAGTCCTGG - Intronic
1057814568 9:98285122-98285144 GACAGGCAGGTGACAAGTGCTGG + Intergenic
1059301980 9:113321204-113321226 GACAAGCAAGTGACTGATTCTGG + Intronic
1059835311 9:118145565-118145587 TACCAGCATGTGACTAGTCCAGG - Intergenic
1187803340 X:23089993-23090015 GACAAGAAGGTGACTGTGGCTGG - Intergenic
1189716839 X:43875789-43875811 GAAAAGCGGGTGAGTGTTCCTGG - Intronic
1200164445 X:154026515-154026537 GAGAAGCAGGTGACAATTTGGGG + Intronic