ID: 1093839177

View in Genome Browser
Species Human (GRCh38)
Location 12:23875025-23875047
Sequence GCCAGCACTAGGAAACACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093839177_1093839182 3 Left 1093839177 12:23875025-23875047 CCATTGTGTTTCCTAGTGCTGGC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1093839182 12:23875051-23875073 AGGTTATGACCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093839177 Original CRISPR GCCAGCACTAGGAAACACAA TGG (reversed) Intronic