ID: 1093839179

View in Genome Browser
Species Human (GRCh38)
Location 12:23875036-23875058
Sequence CATAACCTTGGGCCAGCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093839179_1093839184 22 Left 1093839179 12:23875036-23875058 CCTAGTGCTGGCCCAAGGTTATG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1093839184 12:23875081-23875103 CTGTGCATCTTAAGACTGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 134
1093839179_1093839182 -8 Left 1093839179 12:23875036-23875058 CCTAGTGCTGGCCCAAGGTTATG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1093839182 12:23875051-23875073 AGGTTATGACCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093839179 Original CRISPR CATAACCTTGGGCCAGCACT AGG (reversed) Intronic