ID: 1093839182 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:23875051-23875073 |
| Sequence | AGGTTATGACCACAAGACAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 113 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 108} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1093839177_1093839182 | 3 | Left | 1093839177 | 12:23875025-23875047 | CCATTGTGTTTCCTAGTGCTGGC | 0: 1 1: 0 2: 1 3: 16 4: 163 |
||
| Right | 1093839182 | 12:23875051-23875073 | AGGTTATGACCACAAGACAGTGG | 0: 1 1: 0 2: 0 3: 4 4: 108 |
||||
| 1093839179_1093839182 | -8 | Left | 1093839179 | 12:23875036-23875058 | CCTAGTGCTGGCCCAAGGTTATG | 0: 1 1: 0 2: 0 3: 5 4: 79 |
||
| Right | 1093839182 | 12:23875051-23875073 | AGGTTATGACCACAAGACAGTGG | 0: 1 1: 0 2: 0 3: 4 4: 108 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1093839182 | Original CRISPR | AGGTTATGACCACAAGACAG TGG | Intronic | ||