ID: 1093843296

View in Genome Browser
Species Human (GRCh38)
Location 12:23933216-23933238
Sequence CAGGGTTAGCTGGAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 553}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093843296 Original CRISPR CAGGGTTAGCTGGAGCAGGA TGG (reversed) Intronic
900400319 1:2470362-2470384 CAGGGCCAGCTTGAGCAGGGAGG + Intronic
901036563 1:6339394-6339416 CAGTGTTGACTGGAGCAGTAAGG - Intronic
901534420 1:9873026-9873048 CAGGGTTTGCTGGTCCTGGAGGG - Intronic
901749557 1:11397470-11397492 CAGGGTTGGCTGCAAGAGGAAGG - Intergenic
902095273 1:13938899-13938921 CAGCTAGAGCTGGAGCAGGAGGG + Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902180588 1:14685382-14685404 CAGGCTGAGCTCCAGCAGGAGGG + Intronic
902836077 1:19047574-19047596 CAGAGTTTACTGGGGCAGGAGGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902923893 1:19683138-19683160 CAGGGCTGGCAGCAGCAGGAAGG + Exonic
904444704 1:30559632-30559654 CTGAGTGAGATGGAGCAGGATGG + Intergenic
904972872 1:34432795-34432817 CAGGGTCAGCTGGGGTTGGATGG - Intergenic
905282968 1:36860685-36860707 CAGGGTGGGCTGGTGAAGGAAGG + Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907751628 1:57268915-57268937 AAGGATTAGCAAGAGCAGGAAGG + Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
910100168 1:83567344-83567366 CAGGCTTGCCTGGAGCAGAAAGG + Intergenic
911339308 1:96617828-96617850 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
911389234 1:97217836-97217858 CCAGGGTGGCTGGAGCAGGAGGG + Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
912711586 1:111953889-111953911 GAGAGTGATCTGGAGCAGGAGGG - Intronic
912724876 1:112050231-112050253 CAGTGTTAACTGGGACAGGAAGG - Intergenic
913049345 1:115103039-115103061 CTGGGTCAGCTGGTCCAGGATGG - Intergenic
913425196 1:118720879-118720901 CAGTGTTAGTTGTAGAAGGATGG - Intergenic
915077398 1:153320399-153320421 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915282598 1:154832832-154832854 CAGCGATGGCTGGGGCAGGATGG - Intronic
915529750 1:156496560-156496582 AAGGGCTGACTGGAGCAGGAGGG - Intronic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915651520 1:157315405-157315427 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
915654570 1:157348567-157348589 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915748496 1:158182988-158183010 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915755647 1:158256896-158256918 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915762525 1:158329516-158329538 CGGGGTGAGCAGGAGCAGCAGGG - Exonic
915940937 1:160117788-160117810 CCGTGGTAGCTGGAGCAGGCTGG - Intronic
916038426 1:160941874-160941896 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
917009848 1:170458371-170458393 GAGGGTTAGATGAAGCAGGGTGG - Intergenic
917163231 1:172080921-172080943 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
917325117 1:173824291-173824313 CAGGCTCAGCTGGAGAGGGACGG - Exonic
918149149 1:181783083-181783105 AAGGATGAGGTGGAGCAGGATGG - Intronic
918851364 1:189694532-189694554 CTTGGTTTCCTGGAGCAGGAAGG - Intergenic
919063967 1:192668932-192668954 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
920126903 1:203700554-203700576 CAGGGGTGGCGGGGGCAGGAGGG + Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920588770 1:207196107-207196129 GAGGGCGAGCTGAAGCAGGATGG + Intergenic
920810802 1:209283767-209283789 AAGTGGGAGCTGGAGCAGGAAGG - Intergenic
921039581 1:211416798-211416820 CAGGCTGAGCCTGAGCAGGACGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
924253486 1:242158610-242158632 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1066140866 10:32502354-32502376 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1066257728 10:33696580-33696602 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066316562 10:34253305-34253327 TAGGCTTTGCTGGAGCATGAGGG - Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066751218 10:38659332-38659354 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1066965826 10:42263759-42263781 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067085027 10:43233672-43233694 CAGGGTCAGCTGGTGCAGCCAGG + Intronic
1069227229 10:65959357-65959379 GAGTGTTAGCTGAAGCAGGGAGG - Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069936612 10:71921869-71921891 CAGGGCCAGCTTGGGCAGGAGGG - Intergenic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1071698530 10:87903819-87903841 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1071821328 10:89284155-89284177 GAGGGGTTGCTGGAGGAGGAGGG + Intronic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072081544 10:92037590-92037612 CCGGGTGAAATGGAGCAGGATGG - Intergenic
1072480600 10:95807481-95807503 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1072775107 10:98183011-98183033 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1072917388 10:99546965-99546987 AAGGGTTAGCGGGAGCAGGATGG - Intergenic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073080949 10:100860370-100860392 AAGTGTTAGCTGGGGCAGGTTGG + Intergenic
1073199523 10:101723838-101723860 GAGGGAAAGCTGGGGCAGGATGG - Intergenic
1074117852 10:110471009-110471031 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1075193236 10:120330577-120330599 CAGGTTTGGCTGGAGCAGAGTGG - Intergenic
1075805396 10:125184955-125184977 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1077018690 11:407902-407924 CAGGGCCAGCAGGACCAGGAGGG + Exonic
1077052073 11:571494-571516 CAGGGGTGGCTGGAGGAGGTGGG - Intergenic
1077150592 11:1071345-1071367 CAGGGTTGGCTGTGGCAGGATGG + Intergenic
1077284658 11:1760262-1760284 CAGGGATAGCAGGCGCAGGTGGG + Intronic
1077481045 11:2814779-2814801 CAGAGGCAGATGGAGCAGGAGGG - Intronic
1078161510 11:8843715-8843737 CAGGGGTGGCATGAGCAGGATGG - Intronic
1078361798 11:10675012-10675034 CAGAGTGACCCGGAGCAGGAAGG + Intronic
1079577783 11:22025130-22025152 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1080334464 11:31180546-31180568 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1081493043 11:43581695-43581717 CAGGGGGAACTGGAGCAGGTGGG + Intronic
1081565899 11:44261144-44261166 CAGGCCTAGCTGGGGGAGGATGG - Exonic
1082834083 11:57639468-57639490 GGGGGTTAGCTGGAGCAGCAGGG - Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1083228133 11:61297422-61297444 CAGGGTGAGGTGGAGCAGGTGGG - Intergenic
1083273127 11:61581848-61581870 CAGGGTTGGAAGGAGAAGGAGGG - Intergenic
1083400995 11:62423546-62423568 CTGGGTTGGCTAGAGAAGGAAGG - Intergenic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083792759 11:64996547-64996569 CTGGGTTATTTGGAGAAGGAAGG + Intronic
1084359478 11:68660305-68660327 GAGGGTTAGATGGGTCAGGAGGG + Intergenic
1085038377 11:73312870-73312892 CAGGGATAGCTGAAGCCAGAAGG - Intronic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1086117279 11:83266277-83266299 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086298187 11:85395426-85395448 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1086449141 11:86899096-86899118 CAGGGTTTGTTGAAGCAGGTGGG - Intronic
1086608371 11:88724752-88724774 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1087311111 11:96545152-96545174 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1087390079 11:97520487-97520509 GAGGGTTAGCAGGAACAGAAGGG + Intergenic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088381102 11:109193320-109193342 GAGGGTGAGTTGAAGCAGGATGG - Intergenic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1089705900 11:120277379-120277401 CAGGGTTAGAAGGAGGTGGAGGG - Intronic
1090224036 11:125057937-125057959 GAGGTTTAGTTGGAGCAGGGTGG + Intergenic
1090248713 11:125236349-125236371 CAGGCTTTCCTGGAACAGGATGG - Intronic
1091192034 11:133704113-133704135 CTGGGTTATCTGGAGCGGGGAGG + Intergenic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091397250 12:161607-161629 CAGGGTTAGCAGGAACATGGAGG + Intronic
1091934169 12:4422342-4422364 CAGGGCTGGGTGGAGAAGGATGG + Intergenic
1092239217 12:6827179-6827201 CAGGGTCAGCTGGGGAAAGATGG - Exonic
1093138250 12:15477595-15477617 CTGGGTTAGCTGTAGCAGCAAGG + Intronic
1093545137 12:20336924-20336946 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1095260499 12:40093755-40093777 CGGGGTCAGCTGGAAAAGGAGGG + Intronic
1096403244 12:51324265-51324287 CACTGTCAGCTGGAGCAGGCCGG + Intronic
1096532057 12:52248493-52248515 GAGGGGCAGCTGGGGCAGGAGGG + Intronic
1096950069 12:55459456-55459478 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1097968113 12:65603219-65603241 AAGGGTAGGGTGGAGCAGGAAGG - Intergenic
1099491947 12:83299592-83299614 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1099758347 12:86885435-86885457 AAGGGTTTTCTGGAGCAGCAAGG - Intergenic
1100417104 12:94389641-94389663 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1101301754 12:103489922-103489944 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1101601335 12:106212697-106212719 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1101827416 12:108231294-108231316 CAGGGGGCGCTGGAGCAGAAAGG - Intronic
1103346896 12:120257146-120257168 CTGGGTGAGCTGGAGCAAGGGGG - Intronic
1103615534 12:122149382-122149404 CAGAGGCAGCTGGAGCAGGATGG - Intergenic
1103851864 12:123938602-123938624 CAGCGTTAGGAGGAGTAGGATGG - Intronic
1104175417 12:126326621-126326643 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1104947543 12:132423354-132423376 CGGGGTTCGCAGGAGCAGGAGGG - Intergenic
1105056136 12:133100872-133100894 CGGGGTGGGGTGGAGCAGGATGG + Intronic
1105201328 13:18182309-18182331 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106546739 13:30737370-30737392 CAGGGTTTGCTAGACCATGATGG - Intronic
1107430510 13:40336196-40336218 ATGGCTCAGCTGGAGCAGGATGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108217645 13:48200901-48200923 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108849509 13:54710306-54710328 GGGGGTTGGGTGGAGCAGGAGGG + Intergenic
1109806598 13:67452421-67452443 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1110071511 13:71184434-71184456 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1110924822 13:81138082-81138104 AAGGGTTAGGTGGATCAGCACGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111102772 13:83609565-83609587 CAGGATTAGCAGGAGTATGAGGG + Intergenic
1111634994 13:90892541-90892563 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1111666633 13:91277774-91277796 CTGGGTGGGATGGAGCAGGATGG + Intergenic
1111689514 13:91544877-91544899 CAGTCTTGGCTGGAGCTGGAGGG + Intronic
1112080118 13:95959813-95959835 CAGTGTTAGCAGGTGCAGGGAGG - Intronic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1112578957 13:100662196-100662218 CAGGGTGAGGTGGAGGAGGGTGG - Intronic
1112578978 13:100662242-100662264 CAGGGTGAGGTGGAGGAGGGTGG + Intronic
1113640811 13:111955482-111955504 CAGGTGCAGCTGGGGCAGGAGGG + Intergenic
1114332650 14:21652649-21652671 GGTGTTTAGCTGGAGCAGGAAGG + Intergenic
1114460204 14:22881790-22881812 CAGGGTTTGAGGGAGCAGAAAGG - Intergenic
1114557707 14:23571319-23571341 CAGGGTTGGCGGGAGGAGGCAGG + Exonic
1116165590 14:41330335-41330357 GAAGGTGAGCTGAAGCAGGACGG - Intergenic
1116401813 14:44516134-44516156 GAGGGTCAGCTGAAGCAGGGCGG - Intergenic
1117049280 14:51844343-51844365 CAGGGTAAGCTGGACTAGGCTGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117581882 14:57159391-57159413 CAGGATTTGCTGGAGTAGAAAGG + Intergenic
1117617170 14:57545357-57545379 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1117756528 14:58980010-58980032 CATGGTTAGCAAGAGGAGGAAGG - Intergenic
1117887608 14:60381772-60381794 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1118450015 14:65892217-65892239 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1118830002 14:69421977-69421999 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1118847097 14:69555644-69555666 CAGGGTGAGATGGGGCAGGAGGG + Intergenic
1119675211 14:76548302-76548324 CAGGGTGGGATGGGGCAGGAAGG - Intergenic
1121470676 14:94151835-94151857 GAGGGTGAGCTGAAGCAGGTTGG - Intronic
1121963060 14:98278924-98278946 CTGGGTTTGCTGAAGCAGAAAGG + Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122689909 14:103527371-103527393 CAGGCTCAGATGGAGCAGGTGGG + Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124368849 15:29091890-29091912 AGGGGCCAGCTGGAGCAGGAGGG + Intronic
1124651933 15:31480458-31480480 CAGGGTCAGCTAGGGCAGCAGGG + Exonic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1125003646 15:34795594-34795616 CAGGGTCAGTTGGAGCAGCCGGG + Exonic
1125601941 15:40920163-40920185 CAGGGTAGTCTGGAGCAGGGAGG - Intergenic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1126074543 15:44896510-44896532 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1126742030 15:51786998-51787020 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1128107324 15:65054559-65054581 CAACTGTAGCTGGAGCAGGAAGG + Exonic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129362013 15:75029989-75030011 AAGGGTTGCCTGGAGCAGGGAGG + Intronic
1129790882 15:78340090-78340112 GAGGGTTAGCTGAAACAAGATGG - Intergenic
1130065290 15:80597651-80597673 CAGGCTGTGCGGGAGCAGGACGG + Exonic
1130147201 15:81283060-81283082 CAGGGCTAGCAGGAGCGGGGTGG + Intronic
1131160895 15:90104130-90104152 CAGGTGGAGCTGGACCAGGAAGG + Intergenic
1132096325 15:98987830-98987852 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1132986949 16:2772246-2772268 CGGGGGTAGCTGGAACAGGGAGG - Intronic
1134235253 16:12460055-12460077 CATAGTTAGCTGTGGCAGGAGGG + Intronic
1135753171 16:25073399-25073421 CAGGGCTTGCTGGGGCCGGAGGG - Intergenic
1135831529 16:25778399-25778421 CAGGCTTAGGTACAGCAGGAAGG + Intronic
1135864978 16:26092761-26092783 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1136139762 16:28281289-28281311 CAGGCTGGGGTGGAGCAGGAGGG - Intergenic
1137046098 16:35663892-35663914 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1138224458 16:55280876-55280898 CAGGGTGTGCTGCAGCTGGACGG + Intergenic
1138347370 16:56328356-56328378 CAGAGTTTTCTGGGGCAGGAAGG - Intronic
1139224375 16:65219922-65219944 AAATGTTAGCTGGAGCAGAAGGG + Intergenic
1139428374 16:66897165-66897187 CAGGGCCAGCTGGAGCAACATGG - Intergenic
1139680246 16:68555916-68555938 CTGAGTTAGCTGGAGCAGTGAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140423621 16:74842038-74842060 CAAGGTTAGCTGGTGCTGGTGGG + Intergenic
1141319033 16:82989399-82989421 CAGTGTGAGCTGGAGAGGGATGG + Intronic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142414575 16:89934424-89934446 GAAGGTATGCTGGAGCAGGAGGG + Intronic
1202994886 16_KI270728v1_random:99497-99519 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1203021573 16_KI270728v1_random:411839-411861 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1142566099 17:841325-841347 CAGGGTTGGCGGCACCAGGATGG - Intronic
1142688294 17:1590593-1590615 CAGGGTTTCCTGGTCCAGGAGGG - Intronic
1142695027 17:1628775-1628797 CCGGGTGAGCTGCAGCAGGGAGG - Intronic
1143720664 17:8806840-8806862 CATGGTGAGCTGGAGTAAGAAGG - Intronic
1143941752 17:10549617-10549639 CAAGGTAAGTGGGAGCAGGACGG - Exonic
1144293984 17:13855635-13855657 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1144589482 17:16512153-16512175 CAGGGACAGCTGGACCAGCAGGG + Intergenic
1145322468 17:21774387-21774409 CAGGGCTAGCTGGGGCTGGGTGG - Intergenic
1146005238 17:29156532-29156554 CAAGGTCAGTTAGAGCAGGAGGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146669007 17:34724022-34724044 CAGGCTGAGCTGGAGCAGGCTGG + Intergenic
1146826056 17:36024056-36024078 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
1147266702 17:39238607-39238629 CAGGGTGAGCTGGAGGTGGTAGG + Intergenic
1147522747 17:41190118-41190140 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147526284 17:41226886-41226908 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147526817 17:41232718-41232740 CAGGGTGTGCTACAGCAGGAAGG - Exonic
1147527319 17:41238253-41238275 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528444 17:41249937-41249959 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528966 17:41255602-41255624 CAGGTTGTGCTGCAGCAGGAAGG - Exonic
1147529873 17:41265609-41265631 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147530455 17:41271542-41271564 CAGGGTGTGCTGCAGCAGGAAGG - Intergenic
1147530868 17:41275914-41275936 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147656797 17:42095725-42095747 CATGCTTACCTGGACCAGGACGG - Intergenic
1147743238 17:42680384-42680406 CAGGGCCAGCTGGAGCAGGTGGG + Exonic
1148453632 17:47798205-47798227 CAGGATTGGGTGGAGAAGGAAGG - Intergenic
1148497287 17:48060441-48060463 CAGGGGTGGCTGGAGCACGGAGG - Exonic
1148753091 17:49957156-49957178 CAGGATTAGCTGGAGAATAAAGG + Intergenic
1149093914 17:52817520-52817542 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1149655312 17:58306736-58306758 CAGGGTCAGGTGGAGTTGGAAGG + Intronic
1150178380 17:63087459-63087481 CATAGTTAGGTGGAACAGGATGG + Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1151064277 17:71132289-71132311 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152698271 17:81806877-81806899 AAGGGGCAGCTGGAGCAGGGTGG - Intronic
1152704307 17:81834814-81834836 CAGGGTGACCTGGAGCAGGTGGG - Exonic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1153759801 18:8319700-8319722 TAGGGATATTTGGAGCAGGAAGG + Intronic
1153795261 18:8616141-8616163 CAGGGGAAGGTCGAGCAGGATGG - Intronic
1153939662 18:9967391-9967413 CAGGGGTACCTGTAACAGGAAGG - Intergenic
1153941605 18:9983109-9983131 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1154288623 18:13084596-13084618 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1157067380 18:44367246-44367268 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1157071660 18:44416065-44416087 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1158396272 18:57080694-57080716 CATGGCTATGTGGAGCAGGAAGG + Intergenic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1160754034 19:748450-748472 CAGGGTGAGCGGGTGCAGGCAGG - Intergenic
1160787096 19:905723-905745 CAGGGCTGCCTGAAGCAGGAAGG + Intronic
1160984577 19:1832432-1832454 CAGGGTTCCCGGGAACAGGAGGG - Intronic
1161513083 19:4682596-4682618 CAGGGCCAGCTGGGGCAGGAGGG + Intronic
1161513403 19:4683759-4683781 CAGGGTTAGCAGGGCCTGGAAGG - Intronic
1161945755 19:7435501-7435523 CAGGGTGAGCAGGTTCAGGATGG + Intronic
1162896123 19:13765487-13765509 CAGGGAGGGCTGGAGCAGAAAGG - Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1164051066 19:21586335-21586357 GAGGGTTTGCTGGGGCAGGGTGG + Intergenic
1165003800 19:32787909-32787931 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165777536 19:38413466-38413488 CAGGGAGAGCTGGAGCAGACAGG + Exonic
1166163725 19:40971440-40971462 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1166240235 19:41486502-41486524 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1168170582 19:54585765-54585787 AAGGGCGAGCTGAAGCAGGATGG - Intronic
1168457607 19:56526211-56526233 GAGGGTGAGCTGAAGCAGGGTGG + Exonic
1168558588 19:57364050-57364072 CAGAGTTAGAACGAGCAGGATGG + Exonic
924980013 2:210890-210912 AAGGGGAAGGTGGAGCAGGAGGG - Intergenic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925248770 2:2410772-2410794 CAGGCTTAGATGGAGCAATAAGG - Intergenic
925615641 2:5742295-5742317 CAGGCTTCCCTGGAGCAAGAAGG - Intergenic
927177961 2:20423519-20423541 GAGGAGTAGGTGGAGCAGGATGG + Intergenic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929666637 2:43838767-43838789 CGGGGTCAGGTGGAGCAGGCAGG - Exonic
929852204 2:45602736-45602758 CTGGGTTGGCAGGAGCATGATGG - Intronic
930323253 2:49882036-49882058 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
931046822 2:58363149-58363171 GAGGATGAGCTGGAGCAGGGAGG - Intergenic
932822788 2:74915628-74915650 CAGGCTCTGCTGGGGCAGGAGGG + Intergenic
934104774 2:88685696-88685718 CAGGATTATCTGGAGCTTGATGG - Intergenic
934314210 2:91901501-91901523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934702656 2:96454572-96454594 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934908958 2:98233003-98233025 CAGAGATAGCAGGAGCAAGAGGG - Intronic
935452582 2:103227183-103227205 CAGGTGTAGCTGGGGTAGGATGG + Intergenic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
935826938 2:106961728-106961750 CAGGGAGCTCTGGAGCAGGATGG - Intergenic
936249427 2:110856271-110856293 CAGGATGGGATGGAGCAGGATGG - Intronic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938952399 2:136267035-136267057 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
943352438 2:186811911-186811933 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943552576 2:189358020-189358042 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
944363007 2:198880768-198880790 CTCAGTTAACTGGAGCAGGAAGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945050741 2:205821913-205821935 CAAGCTCAGCTGGAGGAGGAAGG + Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
946107837 2:217387718-217387740 CAAGGCCACCTGGAGCAGGATGG + Intronic
946504100 2:220280685-220280707 AAGGGTTATGAGGAGCAGGAAGG - Intergenic
947310672 2:228798396-228798418 CTGGCTTATTTGGAGCAGGAAGG + Intergenic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170045466 20:12080599-12080621 CAGAGTGAGATGGAGAAGGAGGG - Intergenic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171971484 20:31567672-31567694 GTGGGGTAGCTGGAGCATGAGGG - Intronic
1172125856 20:32624822-32624844 CAGGCCAAGCTGGAACAGGAAGG - Intergenic
1172987126 20:39000688-39000710 CTGGGTTTCCTGGAGCAGGATGG + Intronic
1173122530 20:40307016-40307038 CAAGATCAGCTGGAGCAGCAGGG - Intergenic
1173296798 20:41766868-41766890 CTGGGTTAGATGGTGCAGAAGGG + Intergenic
1173408803 20:42791396-42791418 CAGGGTTGGCAGGAGAAGGTGGG + Exonic
1174224117 20:48982968-48982990 TAGGGTGAGCTGAAGCAGGGCGG - Intronic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1175287185 20:57844756-57844778 TGGGGTGAGCTGGAGCAGGGGGG + Intergenic
1176040897 20:63065307-63065329 CAGGCGTTGCTGGAGCAGGGTGG + Intergenic
1176716617 21:10355679-10355701 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1177092064 21:16781678-16781700 GAAGGTGAGCTGAAGCAGGATGG + Intergenic
1177111463 21:17034280-17034302 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1180148902 21:45937691-45937713 CAGGGTTTGCAGGTGCAGGTGGG + Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180601719 22:17024257-17024279 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181370035 22:22408677-22408699 CAGGGTTAGCTGCAAAAGGTAGG + Intergenic
1182279538 22:29209734-29209756 AAGAGTTGGCTGGAGCAAGAGGG + Intronic
1183021574 22:35031241-35031263 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1183100436 22:35580472-35580494 CAGGGTGAGCGGGGACAGGAAGG + Intergenic
1183334215 22:37237382-37237404 CAGGGAGAGGTGGAGCAGGAGGG + Intronic
1183466757 22:37983960-37983982 TGGGTTTAGCTGGAGCAGGAAGG - Intronic
1183520833 22:38295251-38295273 CAGGCAAAGCTGGAGCAGAAGGG + Intronic
1183676650 22:39302573-39302595 CAGGGTTAACCTGAACAGGAAGG - Intergenic
1184020036 22:41814622-41814644 CAGGGCTAGGAGGGGCAGGAAGG + Intronic
1184212737 22:43045779-43045801 CTGGGATAGCTGGAGTAGGCTGG - Intronic
1184212746 22:43045818-43045840 CCGGGATAGCTGGAGCAGGCTGG - Intronic
1185388485 22:50547167-50547189 CAAGGGTGGCTGGAGCAGGGAGG + Intergenic
949428176 3:3941855-3941877 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
949460303 3:4284526-4284548 CAGGGTCACCTGTAGCAGAATGG - Intronic
949801281 3:7906631-7906653 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
950493310 3:13319167-13319189 CAGGGTTGGTTAGAGCAGGTCGG + Intronic
951505824 3:23443985-23444007 CACGGTCAGCTGCAGCAGAAGGG - Intronic
952517730 3:34122560-34122582 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
952877394 3:37957772-37957794 GAGGGGTGGCTGGTGCAGGACGG - Intronic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953677655 3:45015914-45015936 CTGGGTCACATGGAGCAGGAGGG - Intronic
953722394 3:45367967-45367989 CAGGATTAGCTGAAACAAGAAGG + Intergenic
954082981 3:48223407-48223429 CAGGGATGGGTGGATCAGGAAGG + Exonic
954608187 3:51929753-51929775 GAAGGGTAGCTGGTGCAGGACGG - Intergenic
954788762 3:53114997-53115019 CTGGGATAGGTGGAGCAAGAGGG - Intronic
957249578 3:77756590-77756612 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958414005 3:93852732-93852754 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
958618442 3:96526811-96526833 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
959059814 3:101605780-101605802 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
961111236 3:124285028-124285050 TAGGGGTAGCAGGAGAAGGAGGG + Intronic
961998324 3:131269524-131269546 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
962243967 3:133776090-133776112 CAAGGTTAGGGGGAGCAGAAAGG - Intronic
963214800 3:142733095-142733117 CTGTGTTAGCTGTAGCAGGGTGG + Intronic
963898584 3:150711981-150712003 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965703342 3:171480944-171480966 CAGGGTTCGCTTCATCAGGAAGG - Intergenic
966937843 3:184725577-184725599 CAGGGGAAGCTGCATCAGGACGG - Intergenic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
970132184 4:12884446-12884468 CAGGGGCACCTGGGGCAGGAGGG - Intergenic
970585671 4:17512051-17512073 CCGGGCTGGCAGGAGCAGGATGG - Exonic
971969495 4:33603715-33603737 CACAGGTAGCTGGAGGAGGATGG + Intergenic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
973631632 4:52825591-52825613 CAGAGAGTGCTGGAGCAGGAAGG + Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
975101616 4:70520744-70520766 CAGGGTGAGATGGAGCAGGCTGG + Intronic
975245778 4:72119624-72119646 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975751144 4:77524692-77524714 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976534412 4:86194042-86194064 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
977057382 4:92211006-92211028 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
977203899 4:94148499-94148521 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
977230473 4:94446574-94446596 CTGGGTGGGATGGAGCAGGACGG - Intergenic
977587302 4:98787817-98787839 GAGAGTTAGGTGGAGAAGGAAGG + Intergenic
977946429 4:102919579-102919601 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
977979238 4:103303379-103303401 CAGGGCTAGCAGGAGCAAGCAGG + Intergenic
978138986 4:105296790-105296812 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
980584005 4:134789394-134789416 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
980876285 4:138665628-138665650 CAGCTTTAGCTGGAGTAGGGTGG - Intergenic
981671455 4:147292316-147292338 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
981749770 4:148082410-148082432 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
981788065 4:148503165-148503187 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
982672242 4:158335016-158335038 CAGTGTTTGCTTGAGCAGCAGGG + Intronic
982853044 4:160342772-160342794 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982909302 4:161118542-161118564 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
984372383 4:178884070-178884092 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
984434069 4:179685648-179685670 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
985794734 5:1953580-1953602 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
985810348 5:2078690-2078712 CAGGCTTTGCTGCATCAGGAAGG + Intergenic
986002626 5:3642283-3642305 CAGTGGCAGCTGGAGCAGCAGGG + Intergenic
986452724 5:7882189-7882211 CAGGGTTCTCTGGAGCTGGTGGG + Intronic
986465378 5:8015985-8016007 CAGGGTTAACTGGAGAAAGTGGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987172026 5:15269143-15269165 CAGGGTAAGCTGGTTTAGGATGG + Intergenic
987196900 5:15536021-15536043 CAGCCTGAGCTGGAGCAGGTGGG - Intronic
988094742 5:26591067-26591089 CCGGGTTAGGTAGAGCAGGATGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988672931 5:33401445-33401467 CAGGGCTAGCTGAACCAGGCAGG + Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
990713065 5:58606070-58606092 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
990970644 5:61502197-61502219 CAGGGATGCCAGGAGCAGGAAGG + Intronic
991575806 5:68102374-68102396 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
993366755 5:87042993-87043015 GAGGGTGAGCTGAAGCAGGTCGG - Intergenic
994622551 5:102179803-102179825 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
994711905 5:103276019-103276041 CAGGGTGTGCTGGAGCAGCGGGG - Exonic
999040007 5:148398516-148398538 TAGAGTTTGCAGGAGCAGGATGG + Intronic
999300579 5:150487691-150487713 CATGGGCAGCTGGAGCAGGAGGG + Intronic
1000052064 5:157572043-157572065 CAGGGTTGCCTTGAGCATGAAGG - Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000591574 5:163165196-163165218 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1000964506 5:167639882-167639904 AATGGATAGCTGGAGCAGGAAGG + Intronic
1001266263 5:170276605-170276627 CTGGGGGAGCTGGGGCAGGAGGG + Intronic
1001684613 5:173584141-173584163 AAGTGTTAGCTGGAGTAGGGGGG + Intergenic
1002712501 5:181203933-181203955 CTGGGAGAGTTGGAGCAGGATGG + Intronic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1002973424 6:2048947-2048969 CAGGGTTAGATGAGGCATGAGGG + Intronic
1003160758 6:3632190-3632212 CTGGGTGGGATGGAGCAGGATGG + Intergenic
1003165915 6:3678147-3678169 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1003245139 6:4376691-4376713 CAGGGCCAGGTGGAACAGGAAGG - Intergenic
1003713590 6:8620090-8620112 GAGGGTTAGCCGAAGCAGGGTGG - Intergenic
1003970973 6:11299010-11299032 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1004169966 6:13288240-13288262 CTGGATCAACTGGAGCAGGAAGG - Exonic
1005499919 6:26420963-26420985 CAGGCATGGCTGGAGCGGGAGGG - Intergenic
1005747093 6:28848590-28848612 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006516540 6:34548770-34548792 GAGGGCTCGCTGGGGCAGGAGGG - Intronic
1006717957 6:36132105-36132127 AGGGGTTTGCTGGAGAAGGATGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007695018 6:43726319-43726341 CAGGGTTAGGTGACGCAGGGAGG + Intergenic
1008430495 6:51410965-51410987 CTGGGATATCTGGAGCTGGATGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1009628622 6:66166650-66166672 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1010171862 6:72984683-72984705 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010422186 6:75688366-75688388 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010447080 6:75960165-75960187 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1010522139 6:76850254-76850276 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1010676938 6:78756269-78756291 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1011578107 6:88827235-88827257 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1012484136 6:99702270-99702292 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012940965 6:105415153-105415175 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1014100077 6:117502044-117502066 TGGGGGTAGCTGGAACAGGAAGG - Intronic
1014122798 6:117745870-117745892 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1014505244 6:122247389-122247411 CATGGTGAGCTGGGGCAGGGAGG + Intergenic
1015263959 6:131270233-131270255 CAGGTGTAGCTGTAACAGGAAGG - Intronic
1016334839 6:142993891-142993913 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1017287270 6:152690414-152690436 CTGGATTATCTGGGGCAGGAGGG - Intergenic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1018094601 6:160374302-160374324 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1019046124 6:169147615-169147637 CAAGGTTAGCTTGGGAAGGATGG - Intergenic
1019706090 7:2497947-2497969 CAGGGTCTGCTGGGGAAGGAGGG + Intergenic
1020693960 7:11392240-11392262 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1020825163 7:13017862-13017884 GTGGGTAAGCTGGAACAGGAAGG - Intergenic
1021306674 7:19040220-19040242 GAGGGCTAGCTGAAGCAGGGTGG - Intronic
1022136069 7:27449518-27449540 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1024372968 7:48607339-48607361 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1024766260 7:52664475-52664497 CTGGAGTGGCTGGAGCAGGAGGG - Intergenic
1025719991 7:64000781-64000803 CGGGGGGAGCGGGAGCAGGACGG + Intergenic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1026400955 7:70012235-70012257 CAGGATTGGCTGGAGGAGGCAGG + Intronic
1026604385 7:71803445-71803467 CAGGGTTTCCTGGAGCAGTCAGG + Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1029608783 7:101615508-101615530 CAGAGTTGGCTGCAGCTGGAGGG - Intronic
1030138996 7:106285594-106285616 CAGGGTCAGGAGGATCAGGAGGG - Intronic
1030166441 7:106560416-106560438 GAGGGCGAGCTGAAGCAGGATGG - Intergenic
1030612720 7:111706489-111706511 GAGGGTGAGCTGAAGCAGGTTGG - Intergenic
1030703166 7:112662857-112662879 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1030838027 7:114312488-114312510 CACGGTTTGCTGGAACAGGAAGG - Intronic
1033544594 7:142388811-142388833 CAGGGAGAGCTGGAACAAGAAGG + Intergenic
1033599645 7:142879710-142879732 GAGGGTTAGCAGGAGCAAGGAGG - Intronic
1034275888 7:149823721-149823743 CAGGGGCTGCTGGAGCAGGCTGG + Intergenic
1034715192 7:153235290-153235312 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1035093811 7:156335654-156335676 CAGCTTGAGCTGGAGCAGGAAGG + Intergenic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1039154045 8:34535545-34535567 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039680916 8:39735501-39735523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1040483116 8:47844468-47844490 CAGTGTTAGATAGATCAGGAAGG + Intronic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041634793 8:60130635-60130657 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1041670953 8:60491517-60491539 CTGGGTTGGCTGGAGCAGCCTGG - Intergenic
1041727575 8:61032231-61032253 CAGGGGTGACAGGAGCAGGAAGG + Intergenic
1041944273 8:63424215-63424237 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1042294483 8:67204503-67204525 TAAGGTTAGCTAGAGCAGGGAGG - Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1043244442 8:77979698-77979720 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1044865596 8:96568160-96568182 CAGGCTTTGCTGGAGAAAGAGGG - Intronic
1044956651 8:97488121-97488143 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1045116479 8:98988351-98988373 AAGGGTTAAGTGGAGAAGGATGG + Intergenic
1045646980 8:104308735-104308757 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045797655 8:106065101-106065123 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1046879257 8:119290291-119290313 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1046880868 8:119306947-119306969 AAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1049696039 8:143984806-143984828 AAGGGGTTGCTGGGGCAGGAGGG - Exonic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1050645274 9:7713072-7713094 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051124767 9:13791687-13791709 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051308766 9:15746771-15746793 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1053139436 9:35673621-35673643 CAGGGTTAGCTGAGGCTGGCTGG + Intronic
1053364970 9:37516312-37516334 CAGGGAGAGCTGTTGCAGGAAGG + Intronic
1053524567 9:38815689-38815711 GAGGGATAGCGGGAGCAGGCTGG + Intergenic
1054196803 9:62040108-62040130 GAGGGATAGCGGGAGCAGGCCGG + Intergenic
1054641602 9:67548586-67548608 GAGGGATAGCGGGAGCAGGCCGG - Intergenic
1056003608 9:82243297-82243319 GAAGGTGAGCTGAAGCAGGATGG - Intergenic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1057363930 9:94400878-94400900 CAGTGGTAGCTGGAGTTGGAGGG - Intronic
1057659406 9:96987188-96987210 CAGTGGTAGCTGGAGTTGGAGGG + Intronic
1057715453 9:97491652-97491674 CTAGCTTAGGTGGAGCAGGATGG + Intronic
1058887386 9:109331591-109331613 CTGGGTTAGCTGGTACAGGCTGG + Intergenic
1059134872 9:111795278-111795300 CAGGGTTAGCCGGAGGGCGAGGG + Intergenic
1059412324 9:114140207-114140229 AATGGTAAGCTGGAGCTGGAAGG + Intergenic
1060807589 9:126587460-126587482 CCAGGGTCGCTGGAGCAGGATGG - Intergenic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061273805 9:129558294-129558316 CAGTGGAGGCTGGAGCAGGATGG - Intergenic
1062047263 9:134430258-134430280 CAGCTTCAGCTGGAGCGGGAAGG + Intronic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1185508253 X:644394-644416 CAGGCTCAGCTGCAGCTGGAAGG + Exonic
1186370094 X:8937687-8937709 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187233963 X:17449173-17449195 CAGCTTTATCTGGAGCAAGATGG - Intronic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1188044879 X:25414023-25414045 GAGGGTTAGCCAAAGCAGGACGG - Intergenic
1188715734 X:33457117-33457139 CTGAGCTATCTGGAGCAGGAGGG - Intergenic
1188954610 X:36418835-36418857 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189021490 X:37346469-37346491 CAGAATTAACTGGATCAGGATGG - Intergenic
1189210892 X:39280999-39281021 GAGGGCTAGCTGAAGCAGCATGG - Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1189575190 X:42343666-42343688 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189937071 X:46080570-46080592 GAGGGCGAGCTGGAGCAGGGTGG - Intergenic
1190648999 X:52550908-52550930 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1191254002 X:58272030-58272052 CAGGGTGAGGTTGAGCAGGCTGG - Intergenic
1191645621 X:63478164-63478186 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191686658 X:63899282-63899304 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1191705040 X:64085545-64085567 GAGGGTGAGTTGAAGCAGGATGG + Intergenic
1191793699 X:64999287-64999309 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1191882455 X:65856630-65856652 GAGGGTGAGCTGAAGCAGGGAGG - Intergenic
1191941756 X:66489041-66489063 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1192200053 X:69060947-69060969 CAGGGTTGGAAGGGGCAGGAAGG - Intergenic
1192598470 X:72437184-72437206 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192825879 X:74695860-74695882 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193435992 X:81475426-81475448 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1194355702 X:92881812-92881834 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194391082 X:93319272-93319294 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194837558 X:98699409-98699431 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194893914 X:99415598-99415620 CAGGGTTAGCATGTGCTGGAGGG + Intergenic
1194959146 X:100215080-100215102 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195097981 X:101524483-101524505 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1195547297 X:106126817-106126839 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195624727 X:106996336-106996358 CAGGGTCAGCTGGAGCAGTAGGG + Intronic
1196139639 X:112246691-112246713 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1196196957 X:112846699-112846721 CTAGGTTAGCCGGAGCAAGAGGG + Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197491872 X:127128104-127128126 CAGGAATAGGTGGAGCAAGATGG + Intergenic
1198085549 X:133278837-133278859 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1198571251 X:137959825-137959847 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198680632 X:139178007-139178029 CAGGGCGAGCTGAAGCAGGGTGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199180952 X:144853792-144853814 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1199292304 X:146119007-146119029 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199383738 X:147200442-147200464 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199939653 X:152612568-152612590 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1200059549 X:153478199-153478221 CAGGGTTTGTGGGAGCAGGCAGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200839576 Y:7767255-7767277 CTGGGCTATATGGAGCAGGAGGG - Intergenic
1200921555 Y:8617965-8617987 CAGGTCTTGCTGGAGGAGGATGG - Intergenic
1200937272 Y:8749195-8749217 CATGTTTTGCTGGAGGAGGAGGG + Intergenic
1201314470 Y:12630071-12630093 GAAGGTGAGCTGGAGCAGGATGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic